Efeito da adição e/ou suplementação de antioxidante no processo de congelação/descongelação de sêmen de cães férteis e subférteis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Qualidade espermática e danos de DNA em espermatozóides criopreservados de touros Nelore jovens, adultos e senis

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Concentrações plasmáticas de testosterona e fertilidade de machos caprinos das raças Boer e Alpina durante as estações reprodutiva e não reprodutiva

Pós-graduação em Medicina Veterinária - FCAV

Efeito da criopreservação sobre a célula espermática em três espécies de felinos: o gato-do-mato-pequeno (Leopardus tigrinus - Schreber. 1775), a jaguatirica (eopardus pardalis - Linnaeus, 1758) e o gato doméstico (Felis catus)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Integridade e funcionalidade dos espermatozóides ovinos submetidos à criopreservação após a incorporação de colesterol, desmosterol, ácido oléico-linoléico e alfa-lactoalbumina

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Inseminação artificial com sêmen congelado em cães

Pós-graduação em Medicina Veterinária - FMVZ

Criopreservação e fertilidade de espermatozoides do ejaculado e recuperados da cauda do epidídimo de garanhões subférteis

Pós-graduação em Medicina Veterinária - FMVZ

Avanços na criopreservação do sêmen ovino I: diluidores e crioprotetores

The effectiveness of using frozen sheep semen in artificial insemination programs requires the development of extenders and freezing protocols that will increase pregnancy rate of inseminated females. This work aimed to survey the main extenders, additives and external and internal cryoprotectants that have been employed to improve the maintenance levels of sperm parameters after the freezing-thawing process. Better rates of post-thawing sheep sperm viability may be obtained with changes in the freezing extender composition, whether by the adjustment of its components or by introducing additives that inhibit the occurrence of sperm changes during the cryopreservation process. Thus, the possible changes proposed must take into consideration the intrinsic characteristics of ram semen and the individual variability among animals. It is important to emphasize that the sperm cryopreservation effectiveness requires that all process steps are conducted in an integrated manner, to maximize the fertility rate of frozen ram semen.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Semen parameters and seminal plasma protein and biochemical profiles of dogs with benign prostatic hyperplasia after botulinum toxin type A intraprostatic injection

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Prostatic acid phosphatase in serum and semen of dogs

The incidence of prostatic malignancy has increased the use of tissue markers to detect cancer. Tissue specific antigens or differentiation antigens are found on the surface of normal cells. Clinically, these antigens are important to diagnose alterations in the tissues and for immunotherapy. The objective of the present study was to evaluate the prostatic acid phosphatase concentration in blood and seminal plasma of intact and healthy dogs at different ages. The evaluation was carried out by spectrophotometer, using a commercial kit. The prostatic acid phosphatase (PAP) levels did not differ according to the age and did not correlate with age or prostatic dimensions verified by ultrasonography. The PAP concentration values varied greatly within each group. However, more studies are necessary to evaluate the role of prostatic acid phosphatase in the canine prostate and its importance as a diagnostic test for prostate disorders.

Semen characteristics of captive common marmoset (Callithrix jacchus): a comparison of a German with a Brazilian colony

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)