884 resultados para nuclear localization sequence recognition (NLS recognition)


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Chronic myelogenous leukemia (CML) results from a chromosomal translocation in hematopoietic stem or early progenitor cells that gives rise to the oncogenic BCR/ABL fusion protein. Clinically, CML has a chronic phase that eventually evolves into an accelerated stage and blast crisis. A CML-specific immune response is thought to contribute to the control of disease. Whether the immune system can also promote disease progression is not known. In the present study, we investigated the possibility that the TNF receptor family member CD27 is present on leukemia stem cells (LSCs) and mediates effects of the immune system on CML. In a mouse model of CML, BCR/ABL+ LSCs and leukemia progenitor cells were found to express CD27. Binding of CD27 by its ligand, CD70, increased expression of Wnt target genes in LSCs by enhancing nuclear localization of active β-catenin and TRAF2- and NCK-interacting kinase (TNIK). This resulted in increased proliferation and differentiation of LSCs. Blocking CD27 signaling in LSCs delayed disease progression and prolonged survival. Furthermore, CD27 was expressed on CML stem/progenitor cells in the bone marrow of CML patients, and CD27 signaling promoted growth of BCR/ABL+ human leukemia cells by activating the Wnt pathway. Since expression of CD70 is limited to activated lymphocytes and dendritic cells, our results reveal a mechanism by which adaptive immunity contributes to leukemia progression. In addition, targeting CD27 on LSCs may represent an attractive therapeutic approach to blocking the Wnt/β-catenin pathway in CML.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The hypothalamo-pituitary-adrenal axis shows functional changes in alcoholics, with raised glucocorticoid release during alcohol intake and during the initial phase of alcohol withdrawal. Raised glucocorticoid concentrations are known to cause neuronal damage after withdrawal from chronic alcohol consumption and in other conditions. The hypothesis for these studies was that chronic alcohol treatment would have differential effects on corticosterone concentrations in plasma and in brain regions. Effects of chronic alcohol and withdrawal on regional brain corticosterone concentrations were examined using a range of standard chronic alcohol treatments in two strains of mice and in rats. Corticosterone was measured by radioimmunoassay and the identity of the corticosterone extracted from brain was verified by high performance liquid chromatography and mass spectrometry. Withdrawal from long term (3 weeks to 8 months) alcohol consumption induced prolonged increases in glucocorticoid concentrations in specific regions of rodent brain, while plasma concentrations remained unchanged. This effect was seen after alcohol administration via drinking fluid or by liquid diet, in both mice and rats and in both genders. Shorter alcohol treatments did not show the selective effect on brain glucocorticoid levels. During the alcohol consumption the regional brain corticosterone concentrations paralleled the plasma concentrations. Type II glucocorticoid receptor availability in prefrontal cortex was decreased after withdrawal from chronic alcohol consumption and nuclear localization of glucocorticoid receptors was increased, a pattern that would be predicted from enhanced glucocorticoid type II receptor activation. This novel observation of prolonged selective increases in brain glucocorticoid activity could explain important consequences of long term alcohol consumption, including memory loss, dependence and lack of hypothalamo-pituitary responsiveness. Local changes in brain glucocorticoid levels may also need to be considered in the genesis of other mental disorders and could form a potential new therapeutic target.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Mitogen-activated protein kinases (MAPKs) regulate key signaling events in eukaryotic cells. In the genomes of protozoan Plasmodium parasites, the causative agents of malaria, two genes encoding kinases with significant homology to other eukaryotic MAPKs have been identified (mapk1, mapk2). In this work, we show that both genes are transcribed during Plasmodium berghei liver stage development, and analyze expression and subcellular localization of the PbMAPK1 protein in liver stage parasites. Live cell imaging of transgenic parasites expressing GFP-tagged PbMAPK1 revealed a nuclear localization of PbMAPK1 in the early schizont stage mediated by nuclear localization signals in the C-terminal domain. In contrast, a distinct localization of PbMAPK1 in comma/ring-shaped structures in proximity to the parasite's nuclei and the invaginating parasite membrane was observed during the cytomere stage of parasite development as well as in immature blood stage schizonts. The PbMAPK1 localization was found to be independent of integrity of a motif putatively involved in ATP binding, integrity of the putative activation motif and the presence of a predicted coiled-coil domain in the C-terminal domain. Although PbMAPK1 knock out parasites showed normal liver stage development, the kinase may still fulfill a dual function in both schizogony and merogony of liver stage parasites regulated by its dynamic and stage-dependent subcellular localization.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Catenins have diverse and powerful roles in embryogenesis, homeostasis or disease progression, as best exemplified by the well-known beta-catenin. The less studied delta-catenin likewise contains a central Armadillo-domain. In common with other p120 sub-class members, it acts in a variety of intracellular compartments and modulates cadherin stability, small GTPase activities and gene transcription. In mammals, delta-catenin exhibits neural specific expression, with its knock-out in mice correspondingly producing cognitive defects and synaptic dysfunctions. My work instead employed the amphibian, Xenopus laevis, to explore delta-catenin’s physiological functions in a distinct vertebrate system. Initial isolation and characterization indicated delta-catenin’s expression in Xenopus. Unlike the pattern observed for mammals, delta-catenin was detected in most adult Xenopus tissues, although enriched in embryonic structures of neural fate as visualized using RNA in-situ hybridization. To determine delta-catenin’s requirement in amphibian development, I employed anti-sense morpholinos to knock-down gene products, finding that delta-catenin depletion results in developmental defects in gastrulation, neural crest migration and kidney tubulogenesis, phenotypes that were specific based upon rescue experiments. In biochemical and cellular assays, delta-catenin knock-down reduced cadherin levels and cell adhesion, and impaired activation of RhoA and Rac1, small GTPases that regulate actin dynamics and morphogenetic movements. Indeed, exogenous C-cadherin, or dominant-negative RhoA or dominant-active Rac1, significantly rescued delta-catenin depletion. Thus, my results indicate delta-catenin’s essential roles in Xenopus development, with contributing functional links to cadherins and Rho family small G proteins. In examining delta-catenin’s nuclear roles, I identified delta-catenin as an interacting partner and substrate of the caspase-3 protease, which plays critical roles in apoptotic as well as non-apoptotic processes. Delta-catenin’s interaction with and sensitivity to caspase-3 was confirmed using assays involving its cleavage in vitro, as well as within Xenopus apoptotic extracts or mammalian cell lines. The cleavage site, a highly conserved caspase consensus motif (DELD) within Armadillo-repeat 6 of delta-catenin, was identified through peptide sequencing. Cleavage thus generates an amino- (1-816) and carboxyl-terminal (817-1314) fragment each containing about half of the central Armadillo-domain. I found that cleavage of delta-catenin both abolishes its association with cadherins, and impairs its ability to modulate small GTPases. Interestingly, the carboxyl-terminal fragment (817-1314) possesses a conserved putative nuclear localization signal that I found is needed to facilitate delta-catenin’s nuclear targeting. To probe for novel nuclear roles of delta-catenin, I performed yeast two-hybrid screening of a mouse brain cDNA library, resolving and then validating its interaction with an uncharacterized KRAB family zinc finger protein I named ZIFCAT. My results indicate that ZIFCAT is nuclear, and suggest that it may associate with DNA as a transcriptional repressor. I further determined that other p120 sub-class catenins are similarly cleaved by caspase-3, and likewise bind ZIFCAT. These findings potentially reveal a simple yet novel signaling pathway based upon caspase-3 cleavage of p120 sub-family members, facilitating the coordinate modulation of cadherins, small GTPases and nuclear functions. Together, my work suggested delta-catenin’s essential roles in Xenopus development, and has revealed its novel contributions to cell junctions (via cadherins), cytoskeleton (via small G proteins), and nucleus (via ZIFCAT). Future questions include the larger role and gene targets of delta-catenin in nucleus, and identification of upstream signaling events controlling delta-catenin’s activities in development or disease progression.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The mammalian target of rapamycin (MTOR) assembles into two distinct complexes: mTOR complex 1 (mTORC1) is predominantly cytoplasmic and highly responsive to rapamycin, whereas mTOR complex 2 (mTORC2) is both cytoplasmic and nuclear, and relatively resistant to rapamycin. mTORC1 and mTORC2 phosphorylatively regulate their respective downstream effectors p70S6K/4EBP1, and Akt. The resulting activated mTOR pathways stimulate protein synthesis, cellular proliferation, and cell survival. Moreover, phospholipase D (PLD) and its product, phosphatidic acid (PA) have been implicated as one of the upstream activators of mTOR signaling. In this study, we investigated the activation status as well as the subcellular distribution of mTOR, and its upstream regulators and downstream effectors in endometrial carcinomas (ECa) and non-neoplastic endometrial control tissue. Our data show that the mTORC2 activity is selectively elevated in endometrial cancers as evidenced by a predominant nuclear localization of the activated form of mTOR (p-mTOR at Ser2448) in malignant epithelium, accompanied by overexpression of nuclear p-Akt (Ser473), as well as overexpression of vascular endothelial growth factor (VEGF)-A isoform, the latter a resultant of target gene activation by mTORC2 signaling via hypoxia-inducible factor (HIF)-2alpha. In addition, expression of PLD1, one of the two major isoforms of PLD in human, is increased in tumor epithelium. In summary, we demonstrate that the PLD1/PA-mTORC2 signal pathway is overactivated in endometrial carcinomas. This suggests that the rapamycin-insensitive mTORC2 pathway plays a major role in endometrial tumorigenesis and that therapies designed to target the phospholipase D pathway and components of the mTORC2 pathway should be efficacious against ECa.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Astrogliosis is induced by neuronal damage and is also a pathological feature of the major aging-related neurodegenerative disorders. The mechanisms that control the cascade of astrogliosis have not been well established. In a previous study, we identified a novel androgen receptor (AR)-interacting protein (p44/WDR77) and found that it plays a critical role in the control of proliferation and differentiation of prostate epithelial cells. In the present study, we found that deletion of the p44 gene in the mouse brain caused accelerated aging with dramatic astrogliosis. The p44/WDR77 is expressed in astrocytes and loss of p44/WDR77 expression in astrocytes leads to astrogliosis. Our results reveal a novel role of p44/WDR77 in astrocytes, which may explain the well-documented role of androgens in suppression of astrogliosis. While many of detailed mechanisms of astrocyte activation remain to be elucidated, a number pathways have been implicated in astrocyte activation including p21Cip1 and the NF-kB pathway. Astrocytic activation induced by p44/WDR77 gene deletion was associated with a significant increase of p21Cip1 expression and NF-kB activation characterized by p65 nuclear localization. We found that down-regulation of p21Cip1 expression inhibited astrocyte activation induced by the p44/WDR77 deletion and was accompanied by a decreased p65 nuclear localization. While p21Cip1 role in astrocyte activation and NF-kB activation is not well understood, studies of other cell cycle regulators have implicated cell cycle control systems as modulators of astrocyte activation, thus p21Cip1 could induce secondary effect to induce p65 nuclear localization. However, p65 knockdown completely relieved the inhibition of astrocyte growth induced by the p44/WDR77 deletion, while p21Cip1 knockdown only partially recovered this inhibition. Thus, NF-kB activity performs additional regulatory actions not mediated by p21Cip1. These analyses imply that p4/WDR77 suppresses astrocyte activation through modulating p21Cip1 expression and NF-kB activation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The origin and structure of P55$\sp{\rm gag},$ a gag encoded polyprotein lacking the nucleocapsid protein, NCp10, have been explored. Evidence shows that P55$\sp{\rm gag}$ is formed by non-viral proteolytic cleavage of the Moloney murine leukemia virus (MoMuLV)gag precursor protein, Pr65$\sp{\rm gag}.$ P55$\sp{\rm gag}$ is produced in cells infected by a viral protease deletion mutant and by a recombinant murine sarcoma virus known to lack the protease gene, implying that a cellular protease is responsible for the cleavage. Structural and immunological studies show that the protein cleavage site is upstream of the CAp30-NCp10 viral proteolytic junction, implying that P55$\sp{\rm gag}$ lacks the carboxy-terminal residues of CAp30. During the course of studying P55$\sp{\rm gag},$ another protein was discovered, which I named nucleocapsid-related protein(NCRP). NCRP possesses the portion of CAp30 that is lacking in P55$\sp{\rm gag}.$ NCRP possesses antigenic epitopes present in CAp30 and NCp10. NCRP was observed in virus lysates and in nuclear lysates of MoMuLV infected cells; it was not detected in the cytoplasmic fractions of MoMuLV infected cells. Our results indicated that NCRP originates from Pr65$\sp{\rm gag},$ resulting from the same cellular proteolytic cleavage event that produces the viral cellular protein P55$\sp{\rm gag}.$ P55$\sp{\rm gag}$- and NCRP-like proteins also were observed in AKV murine leukemia virus (AKV MuLV) and feline leukemia virus (FeLV) infected cells and in their respective virus particles. The site of cleavage that yields P55$\sp{\rm gag}$ and NCRP is within the carboxy terminus of CAp30, likely within a motif highly conserved among mammalian type C retroviruses. This new motif, called the capsid conserved motif (CCM), overlaps a region containing both a possible bipartite nuclear targeting sequence and a region homologous with the U1 small nuclear ribonucleoprotein 70-kD protein. This domain, when intact, may act as a nuclear targeting sequence for the gag precursor proteins Pr65$\sp{\rm gag}$ and CAp30. Nuclei of cells infected with MoMuLV were examined for the presence of gag proteins. Both Pr65$\sp{\rm gag}$ and CAp30 were detected in the nuclear fraction of MoMuLV, AKV MuLV and FeLV infected cells. P55$\sp{\rm gag}$ was never detected in the nucleus of MoMuLV, AKV MuLV and FeLV infected cells or in their respective virus particles. I propose that NCRP may be involved in sequestering viral genomic RNA for the purposes of encapsidation and intracellular viral genomic RNA dimerization. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The contents of this dissertation include studies on the mechanisms by which FGF and growth factor down-stream kinases inactivate myogenin; characterization of myogenin phosphorylation and its role in regulation of myogenin activity; analysis the C-terminal transcriptional activation domain of myogenin; studies on the nuclear localization of myogenin and characterization of proteins that interact with PKC.^ Activation of muscle transcription by the MyoD family requires their heterodimerization with ubiquitous bHLH proteins such as the E2A gene products E12 and E47. I have shown that dimerization with E2A products potentiates phosphorylation of myogenin at serine 43 in its amino-terminus and serine 170 in the carboxyl-terminal transcription activation domains. Mutations of these sites resulted in enhanced transcriptional activity of myogenin, suggesting that their phosphorylation diminishes myogenin's transcriptional activity. Consistent with the role of phosphorylation at serine 170, analysis of the carboxyl-terminal transcriptional activation domain by deletion has revealed a stretch of residues from 157 to 170 which functions as a negative element for myogenin activity.^ In addition to inducing phosphorylation of myogenin, E12 also localizes myogenin to the nucleus. The DNA binding and dimerization mutants of myogenin show various deficiencies in nuclear localization. Cotransfection of E12 with the DNA binding mutants, but not a dimerization mutant, greatly enhances their nuclear binding. These data suggest that the nuclear localization signal is located in the DNA binding region and myogenin can also be nuclear localized by virtue of dimerizing with a nuclear protein.^ FGF is one of the most potent inhibitors of myogenesis and activates many down-stream pathways to exert its functions. One of these pathway is the MAP kinase pathway. Studies have shown that Raf-1 and Erk-1 kinase inactivate transactivation by myogenin and E proteins independent of DNA binding. The other is the PKC pathway. In transfected cells, FGF induces phosphorylation of thr-87 that maps to the previously identified PKC sites in the DNA binding domain of myogenin. Myogenin mutant T-N87 could resist the inhibition directed to the bHLH domain by FGF, suggesting that FGF inactivates myogenin by inducing phosphorylation of this site. In C2 myotubes, where FGF receptors are lost, the phosphatase inhibitor, okadaic acid, and phorbal ester PdBu, can also induce the phosphorylation of thr-87. This result supports the previous observation and suggests that in myotubes, other mechanisms, such as innervation, may inactivate myogenin through PKC induced phosphorylation.^ Many functions of PKC have been well documented, yet, little is known about the activators or effectors of PKC or proteins that mediate PKC nuclear localizations. Identification of PKC binding proteins will help to understand the molecular mechanism of PKC function. Two proteins that interact with the C kinase (PICKS) have been characterized, PICK-1 and PICK-2. PICK1 interacts with two conserved regions in the catalytic domain of PKC. It is localized to the perinuclear region and is phosphorylated in response to PKC activation. PICK2 is a novel protein with homology to the heat shock protein family. It interacts extensively with the catalytic domain of PKC and is localized in the cytoplasm in a punctate pattern. PICK1 and PICK2 may play important roles in mediating the actions of PKC. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Bcr-Abl fusion oncogene which resulted from a balanced reciprocal translocation between chromosome 9 and 22, t(9;22)(q11, q34), encodes a 210 KD elevated tyrosine specific protein kinase that is found in more than 95 percent of chronic myelogenous leukemia patients (CML). Increase of level of phosphorylation of tyrosine is observed on cell cycle regulatory proteins in cells overexpressing the Bcr-Abl oncogene, which activates multiple signaling pathways. In addition, distinct signals are required for transforming susceptible fibroblast and hematopoietic cells, and the minimal signals essential for transforming hematopoietic cells are yet to be defined. In the present study, we first established a tetracycline repressible p210$\rm\sp{bcr-abl}$ expression system in a murine myeloid cell line 32D c13, which depends on IL3 to grow in the presence of tetracycline and proliferate independent of IL3 in the absence of tetracycline. Interestingly, one of these sublines does not form tumors in athymic nude mice suggesting that these cells may not be completely transformed. These cells also exhibit a dose-dependent growth and expression of p210$\rm\sp{bcr-abl}$ at varying concentrations of tetracycline in the culture. However, p210$\rm\sp{bcr-abl}$ rescues IL3 deprivation induced apoptosis in a non-dose dependent fashion. DNA genotoxic damage induced by gamma-irradiation activates c-Abl tyrosine kinase, the cellular homologue of p210$\rm\sp{bcr-abl},$ and leads to activation of p38 MAP kinase in the cells. However, in the presence of p210$\rm\sp{bcr-abl}$ the irradiation failed to activate the p38 MAP kinase as examined by an antibody against phosphorylated p38 MAP kinase. Similarly, an altered tyrosine phosphorylation of the JAK1-STAT1 pathways was identified in cells constitutively overexpressing p210$\rm\sp{bcr-abl}.$ This may provided a molecular mechanism for altered therapeutic response of CML patients to IFN-$\alpha.$^ Bcr-Abl oncoprotein has multiple functional domains which have been identified by the work of others. The Bcr tetramerization domain, which may function to stabilize the association of the Bcr-Abl with actin filaments in p210$\rm\sp{bcr-abl}$ susceptible cells, are essential for transforming both fibroblast and hematopoietic cells. We designed a transcription unit encoding first 160 amino acids polypeptide of Bcr protein to test if this polypeptide can inhibit the transforming activity of the p210$\rm\sp{bcr-abl}$ oncoprotein in the 32D c13 cells. When this vector was transfected transiently along with the p210$\rm\sp{bcr-abl}$ expression vector, it can block the transforming activity of p210$\rm\sp{bcr-abl}.$ On the other hand, the retinoblastoma tumor suppressor protein (Rb), a naturally occurring negative regulator of the c-Abl kinase, the cellular homologue of Bcr-Abl oncoprotein, binds to and inhibits the c-Abl kinase in a cell cycle dependent manner. A polypeptide obtained from the carboxyl terminal end of the retinoblastoma tumor suppressor protein, in which the nuclear localization signal was mutated, was used to inhibit the kinase activity of the p210$\rm\sp{bcr-abl}$ in the cytoplasm. This polypeptide, called Rb MC-box, and its wild type form, Rb C-box, when overexpressed in the 32D cells are mainly localized in the cytoplasm. Cotransfection of a plasmid transcription unit coding for this polypeptide and the gene for the p210$\rm\sp{bcr-abl}$ resulted in reduced plating efficiency of p210$\rm\sp{bcr-abl}$ transfected IL3 independent 32D cells. Together, these results may lead to a molecular approach to therapy of CML and an in vitro assay system to identify new targets to which an inhibitory polypeptide transcription unit may be directed. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Amyotrophic lateral sclerosis (ALS) is a progressive motor neuron disease, fatal within 1 to 5 years after onset of symptoms. About 3 out of 100’000 persons are diagnosed with ALS and there is still no cure available [1, 2]. 95% of all cases occur sporadically and the aetiology remains largely unknown [XXXX]. However, up to now 16 genes were identified to play a role in the development of familial ALS. One of these genes is FUS that encodes for the protein fused in sarcoma/translocated in liposarcoma (FUS/TLS). Mutations in this gene are responsible for some cases of sporadic as well as of inherited ALS [3]. FUS belongs to the family of heterogeneous nuclear ribonucleoproteins and is predicted to be involved in several cellular functions like transcription regulation [4], RNA splicing [5, 6], mRNA transport in neurons [7] and microRNA processing [8]. Aberrant accumulation of mutated FUS has been found in the cytoplasm of motor neurons from ALS patients [9]. The mislocalization of FUS is based on a mutation in the nuclear localization signal of FUS [10]. However, it is still unclear if the cytoplasmic localization of FUS leads to a toxic gain of cytoplasmic function and/or a loss of nuclear function that might be crucial in the course of ALS. The goal of this project is to characterize the impact of ALS-associated FUS mutations on in vitro differentiated motor neurons. To this end, we edit the genome of induced pluripotent stem cells (iPSC) using transcription activator-like effector nucleases (TALENs) [11,12] to create three isogenic cell lines, each carrying an ALS-associated FUS mutation (G156E, R244C and P525L). These iPSC’s will then be differentiated to motor neurons according to a recently establishe protocol (Ref Wichterle) and serve to study alterations in the transcriptome, proteome and metabolome upon the expression of ALS-associated FUS. With this approach, we hope to unravel the molecular mechanism leading to FUS-associated ALS and to provide new insight into the emerging connection between misregulation of RNA metabolism and neurodegeneration, a connection that is currently implied in a variety of additional neurological diseases, including spinocerebellar ataxia 2 (SCA-2), spinal muscular atrophy (SMA), fragile X syndrome, and myotonic dystrophy.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Amyotrophic lateral sclerosis (ALS) is a progressive motor neuron disease, fatal within 1 to 5 years after onset of symptoms. About 3 out of 100’000 persons are diagnosed with ALS and there is still no cure available [1, 2]. 95% of all cases occur sporadically and the aetiology remains largely unknown [3]. However, up to now 16 genes were identified to play a role in the development of familial ALS. One of these genes is FUS that encodes for the protein fused in sarcoma (FUS). Mutations in this gene are responsible for some cases of sporadic as well as of inherited ALS [4]. FUS belongs to the family of heterogeneous nuclear ribonucleoproteins and is predicted to be involved in several cellular functions like transcription regulation, RNA splicing, mRNA transport in neurons and microRNA processing [5] Aberrant accumulation of mutated FUS has been found in the cytoplasm of motor neurons from ALS patients [6]. The mislocalization of FUS is based on a mutation in the nuclear localization signal of FUS [7]. However, it is still unclear if the cytoplasmic localization of FUS leads to a toxic gain of cytoplasmic function and/or a loss of nuclear function that might be crucial in the course of ALS. The goal of this project is to characterize the impact of ALS-associated FUS mutations on in vitro differentiated motor neurons. To this end, we edit the genome of induced pluripotent stem cells (iPSC) using transcription activator-like effector nucleases (TALENs) [8,9] to create three isogenic cell lines, each carrying an ALS-associated FUS mutation (G156E, R244C and P525L). These iPSC’s will then be differentiated to motor neurons according to a recently established protocol [10] and serve to study alterations in the transcriptome, proteome and metabolome upon the expression of ALS-associated FUS. With this approach, we hope to unravel the molecular mechanism leading to FUS-associated ALS and to provide new insight into the emerging connection between misregulation of RNA metabolism and neurodegeneration, a connection that is currently implied in a variety of additional neurological diseases, including spinocerebellar ataxia 2 (SCA-2), spinal muscular atrophy (SMA), fragile X syndrome, and myotonic dystrophy. [1] Cleveland, D.W. et al. (2001) Nat Rev Neurosci 2(11): 806-819 [2] Sathasivam, S. (2010) Singapore Med J 51(5): 367-372 [3] Schymick, J.C. et al. (2007) Hum Mol Genet Vol 16: 233-242 [4] Pratt, A.J. et al. (2012). Degener Neurol Neuromuscul Dis 2012(2): 1-14 [5] Lagier-Tourenne, C. Hum Mol Genet, 2010. 19(R1): p. R46-64 [6] Mochizuki, Y. et al. (2012) J Neurol Sci 323(1-2): 85-92 [7] Dormann, D. et al. (2010) EMBO J 29(16): 2841-2857 [8] Hockemeyer, D. et al. (2011) Nat Biotech 29(8): 731-734 [9] Joung, J.K. and J.D. Sander (2013) Nat Rev Mol Cell Biol 14(1): 49-55 [10]Amoroso, M.W. et al. (2013) J Neurosci 33(2): 574-586.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A combination of psoralens and ultraviolet-A radiation referred to as PUVA, is widely used in the treatment of psoriasis. PUVA therapy is highly effective in killing hyperproliferative cells, but its mechanism of action has not been fully elucidated. Psoralen binds to DNA, and upon photoactivation by UVA, it forms monofunctional adducts and interstrand cross-links. PUVA treatment has been shown to be mutagenic and to produce tumors in animals. In addition, epidemiological studies have reported a 10 to 15 percent increased risk of developing squamous cell carcinoma in individuals treated chronically with PUVA. However, it remains a treatment for skin disorders such as psoriasis because its benefits outweigh its risks. The widespread use of PUVA therapy and its associated cancer risk requires us to understand the molecular mechanisms by which PUVA induces cell death. Immortalized JB6 mouse epidermal cells, p53−/− mice, and Fas Ligand−/− (gld) mice were used to investigate the molecular mechanism by which PUVA kills cells. Treatment of JB6 cells with 10 μg/ml 8-methoxypsoralen followed by irradiation with 20 kJ/m2 UVA resulted in cell death. The cells exhibited morphological and biochemical characteristics of apoptosis such as chromatin condensation, DNA ladder formation, and TUNEL-positivity. PUVA treatment stabilized and phosphorylated p53 leading to its activation, as measured by nuclear localization and induction of p21Waf/Cip1, a transcriptional target of p53. Subsequent in vivo studies revealed that there was statistically significantly less apoptosis in p53 −/− mice than in p53+/+ mice at 72 hours after PUVA. In addition, immunohistochemical analysis revealed more Fas and FasL expression in p53+/+ mice than in p53−/− mice, suggesting that p53 is required to transcriptionally activate Fas, which in turn causes the cells to undergo apoptosis. Studies with gld mice confirmed a role for Fas/FasL interactions in PUVA-induced apoptosis. There was statistically significantly less apoptosis in gld mice compared with wild-type mice 24, 48, and 72 hours after PUVA. These results demonstrate that PUVA-induced apoptosis in mouse epidermal cells requires p53 and Fas/FasL interactions. These findings may be important for designing effective treatments for diseases such as psoriasis without increasing the patient's risk for skin cancer. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

15-Lipoxygenase 2 (15-LOX2) is a recently cloned human lipoxygenase that shows tissue-restricted expression in prostate, lung, skin, and cornea. The protein level and enzymatic activity of 15-LOX2 have been shown to be down-regulated in prostate cancers compared with normal and benign prostate tissues. We report the cloning and functional characterization of 15-LOX2 and its three splice variants (termed 15-LOX2sv-a, 15-LOX2sv-b, and 15-LOX2sv-c) from primary prostate epithelial (NHP) cells. Western blotting with multiple NHP cell strains and prostate cancer (PCa) cell lines reveals that the expression of 15-LOX2 is lost in all PCa cell lines, accompanied by decreased enzymatic activity. 15-LOX2 is expressed at multiple subcellular locations, including cytoplasm, cytoskeleton, cell-cell border, and nucleus. Surprisingly, the three splice variants of 15-LOX2 are mostly excluded from the nucleus. To elucidate the relationship between nuclear localization, enzymatic activity, and tumor suppressive functions, we established PCa cell clones stably expressing 15-LOX2 or 15-LOX2sv-b. The 15-LOX2 clones express 15-LOX2 in the nuclei and possess robust enzymatic activity, whereas 15-LOX2sv-b clones show neither nuclear protein localization nor arachidonic acid-metabolizing activity. Interestingly, both 15-LOX2- and 15-LOX2sv-b-stable clones proliferate much slower in vitro when compared with control clones. When orthotopically implanted in nude mouse prostate, both 15-LOX2 and 15-LOX2sv-b suppress PC3 tumor growth in vivo. Finally, cultured NHP cells lose the expression of putative stem/progenitor cell markers, slow down in proliferation, and enter senescence. Several pieces of evidence implicate 15-LOX2 plays a role in replicative senescence of NHP cells: (1) promoter activity and the mRNA and protein levels of 15-LOX2 and its splice variants are upregulated in serially passaged NHP cells, which precede replicative senescence and occur in a cell-autonomous manner; (2) PCa cells stably expressing 15-LOX2 or 15-LOX2sv-b show a passage-related senescence-like phenotype; (3) enforced expression of 15-LOX2 or 15-LOX2sv-b in young NHP cells induce partial cell-cycle arrest and senescence-like phenotypes. Together, these results suggest that 15-LOX2 suppress prostate tumor development and do not necessarily depend on arachidonic acid-metabolizing activity and nuclear localization. Also, 15-LOX2 may serve as an endogenous prostate senescence gene and its tumor-suppressing functions might be associated with its ability to induce cell senescence. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Several immune pathologies are the result of aberrant regulation of T lymphocytes. Pronounced T cell proliferation can result in autoimmunity or hematologic malignancy, whereas loss of T cell activity can manifest as immunodeficiency. Thus, there is a critical need to characterize the signal transduction pathways that mediate T cell activation so that novel and rational strategies to detect and effectively control T cell mediated disease can be achieved. ^ The first objective of this dissertation was to identify and characterize novel T cell regulatory proteins that are differentially expressed upon antigen induced activation. Using a functional proteomics approach, two members of the prohibitin (Phb) family of proteins, Phb1 and Phb2, were determined to be upregulated upon activation of primary human T cells. Furthermore, their regulated expression was dependent upon CD3 and CD28 signaling pathways which synergistically increased their expression. In contrast to previous reports of Phb nuclear localization, both proteins were determined to localize to the mitochondrial inner membrane of human T cells. Additionally, novel Phb phosphorylation sites were identified and characterized using mass spectrometry, phosphospecific antibodies and site directed mutagenesis. ^ Prohibitins have been proposed to play important roles in cancer development however the mechanism of action has not been elucidated. The second objective of this dissertation was to define the functional role of Phbs in T cell activity, survival and disease. Compared to levels in normal human T cells, Phb expression was higher in the human tumor T cell line Kit225 and subcellularly localized to the mitochondrion. Ablation of Phb expression by siRNA treatment of Kit225 cells resulted in disruption of mitochondrial membrane potential and significantly enhanced their sensitivity to cell death, suggesting they serve a protective function in T cells. Furthermore, Q-RT-PCR analysis of human oncology cDNA expression libraries indicated the Phbs may represent hematological cancer biomarkers. Indeed, Phb1 and Phb2 protein levels were 6-10 fold higher in peripheral blood mononuclear cells isolated from malignant lymphoma and multiple myeloma patients compared to healthy individuals. ^ Taken together, Phb1 and Phb2 are novel phosphoproteins upregulated during T cell activation and transformation to function in the maintenance of mitochondrial integrity and perhaps energy metabolism, thus representing previously unrecognized intracellular biomarkers and therapeutic targets for regulating T cell activation and hematologic malignancies. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^