990 resultados para fragile state
Resumo:
The concept of local concurrence is used to quantify the entanglement between a single qubit and the remainder of a multiqubit system. For the ground state of the BCS model in the thermodynamic limit the set of local concurrences completely describes the entanglement. As a measure for the entanglement of the full system we investigate the average local concurrence (ALC). We find that the ALC satisfies a simple relation with the order parameter. We then show that for finite systems with a fixed particle number, a relation between the ALC and the condensation energy exposes a threshold coupling. Below the threshold, entanglement measures besides the ALC are significant.
Resumo:
Seven species of Anacroneuria Klapalek are considered; of these 4 were known, A. debilis (Pictet, 1841), A. flintorum Froehlich, 2002, A. toriba Froehlich, 2002 (the female is described herein), and A. vanini Froehlich, 2004. Three are new: A. mantiqueirae, A. simulans, and A. tabatae.
Resumo:
Social wasp diversity in Semideciduous Seasonal Forests of the northeast of Sao Paulo State is poorly known, causing a lack of information on the diversity of these wasps from these areas which have been degraded. The objective of this work was to evaluate the social wasp (Vespidae, Polistinae) diversity in a Semideciduous Seasonal Forest of the northeast of Sao Paulo State and to compare three different kinds of sampling methodology. Surveys were conducted from August 2005 to September 2006 in the interior, edge and matrix of a Semideciduous Seasonal Forest fragment in Patrocinio Paulista city, Sao Paulo State. Three methodologies were used: 1. Active collection in flowers, 2. Searching for nests, 3. Active collection with attractive liquid. Thirty species of social wasps were collected in the fragment, but the diversity was highest in the edge. Active collection with attractive liquid was the most efficient methodology. Despite the high levels of deforestation, forest fragments in Sao Paulo State have a high diversity of social wasps, reinforcing the importance of their preservation.
Resumo:
We theoretically study the Hilbert space structure of two neighboring P-donor electrons in silicon-based quantum computer architectures. To use electron spins as qubits, a crucial condition is the isolation of the electron spins from their environment, including the electronic orbital degrees of freedom. We provide detailed electronic structure calculations of both the single donor electron wave function and the two-electron pair wave function. We adopted a molecular orbital method for the two-electron problem, forming a basis with the calculated single donor electron orbitals. Our two-electron basis contains many singlet and triplet orbital excited states, in addition to the two simple ground state singlet and triplet orbitals usually used in the Heitler-London approximation to describe the two-electron donor pair wave function. We determined the excitation spectrum of the two-donor system, and study its dependence on strain, lattice position, and interdonor separation. This allows us to determine how isolated the ground state singlet and triplet orbitals are from the rest of the excited state Hilbert space. In addition to calculating the energy spectrum, we are also able to evaluate the exchange coupling between the two donor electrons, and the double occupancy probability that both electrons will reside on the same P donor. These two quantities are very important for logical operations in solid-state quantum computing devices, as a large exchange coupling achieves faster gating times, while the magnitude of the double occupancy probability can affect the error rate.
Resumo:
The incidence of 21-hydroxylase deficiency (CYP21 D) congenital adrenal hyperplasia (CAH) in Brazil is purportedly one of the highest in the world (1:7,533). However, this information is not based on official data. The aim of this study was to determine the incidence of CYP21 D CAH in the state of Goias, Brazil, based on the 2005 results of government-funded mandatory screening. Of the live births during this period, 92.95% were screened by heel-prick capillary 17 alpha-hydroxyprogesterone (17-OHP). Of these, 82,343 were normal, 28 were at high risk for CAH and 232 at low risk for CAH. Eight cases, all from the high risk group, were confirmed. Eight asymptomatic children at 6-18 months of age still have high 17-OHP levels and await diagnostic definition. Based on the number of confirmed CYP21 D CAH cases among the 82,603 screened, the estimated annual incidence of the disease was 1:10,325, lower than the previously reported rate in Brazil.
Resumo:
China's state sector reform process is examined through the key sector of agriculture. A preview of aggregate statistics and broader reform measures indicate the declining role of the state. However, a systematic analysis of administrative, service and enterprise structures reveal the nuances of how the state has retained strong capacity to guide development of the agricultural sector. State and Party policy makers aim not only to support the livelihoods of hundreds of millions of farmers, but also to pursue agricultural modernization in the context of rapid industrialization. These goals are unlikely to be achieved through a wholesale transfer of functions to the private sector, so the state has maintained or developed new mechanisms of influence, particularly in the areas of service provision and enterprise development.
Resumo:
The incidence of cutaneous leishmaniasis (CL) is increasing and there is limited surveillance of Leishmania species throughout the world. We identified the species associated with CL in a region of Amazonia, an area recognized for its Leishmania species variability. Clinical findings were analyzed and correlated with the species identified in 93 patients. PCR assays were based on small subunit ribosomal DNA (SSU-rDNA) and G6PD, and were performed in a laboratory located 3,500 km away. Leishmania (V.) braziliensis was identified in 53 patients (57%). The other 40 patients (43%) carried a different species (including six cases of L (L) amazonensis). Molecular methods can be employed, using special media, to allow transport to distant laboratories. L (V.) braziliensis is the most common species in the area of Para. The location of ulcers can suggest CL species (C) 2010 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.
Resumo:
We calculate the stationary state of the system of two non-identical two-level atoms driven by a finite-bandwidth two-mode squeezed vacuum. It is well known that two identical two-level atoms driven by a broadband squeezed vacuum may decay to a pure state, called the pure two-atom squeezed state, and that the presence of the antisymmetric state can change its purity. Here, we show that for small interatomic separations the stationary state of two non-identical atoms is not sensitive to the presence of the antisymmetric state and is the pure two-atom squeezed state. This effect is a consequence of the fact that in the system of two non-identical atoms the antisymmetric state is no longer the trapping state. We also calculate the squeezing properties of the emitted field and find that the squeezing spectrum of the output field may exhibit larger squeezing than that in the input squeezed vacuum. Moreover, we show that squeezing in the total field attains the optimum value which can ever be achieved in the field emitted by two atoms.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
A state-contingent model of production under uncertainty is developed and compared with more traditional models of production under uncertainty. Producer behaviour with both production and price risk, in the presence and in the absence of futures and forward markets, is analysed in this state-contingent framework. Conditions for the optimal hedge to be positive or negative are derived. We also show that, under plausible conditions, a risk-averse producer facing price uncertainty and the ability to hedge price risk will never willingly adopt a nonstochastic technology. New separation results, which hold in the presence of both price and production risk, are then developed. These separation results generalize Townsend's spanning results by reducing the number of necessary forward markets by one.
Resumo:
Changes in molecular motion in blends of PEO-PVPh have been studied using measurements of C-13 T-1 rho relaxation times. C-13 T-1 rho relaxation has been confirmed as arising from spin-lattice interactions by observation of the variation in T-1 rho with rf field strength and temperature. In the pure homopolymers a minimum in T-1 rho is observed at ca. 50 K above the glass transition temperatures detected by DSC. After blending, the temperature of the minimum in T-1 rho for PEO increased, while that for PVPh decreased, however, the minima, which correspond to the temperatures where the average correlation times for reorientation are close to 3.1 mu s, are separated by 45 K (in a 45% PEO-PVPh blend). These phenomena are explained in terms of the local nature of T-1 rho measurements. The motions of the individual homopolymer chains are only partially coupled in the blend. A short T-1 rho has been observed for protonated aromatic carbons, and assigned to phenyl rings undergoing large-angle oscillatory motion, The effects of blending, and temperature, on the proportion of rings undergoing oscillatory motion are analyzed.
Resumo:
Pattern recognition methods have been successfully applied in several functional neuroimaging studies. These methods can be used to infer cognitive states, so-called brain decoding. Using such approaches, it is possible to predict the mental state of a subject or a stimulus class by analyzing the spatial distribution of neural responses. In addition it is possible to identify the regions of the brain containing the information that underlies the classification. The Support Vector Machine (SVM) is one of the most popular methods used to carry out this type of analysis. The aim of the current study is the evaluation of SVM and Maximum uncertainty Linear Discrimination Analysis (MLDA) in extracting the voxels containing discriminative information for the prediction of mental states. The comparison has been carried out using fMRI data from 41 healthy control subjects who participated in two experiments, one involving visual-auditory stimulation and the other based on bimanual fingertapping sequences. The results suggest that MLDA uses significantly more voxels containing discriminative information (related to different experimental conditions) to classify the data. On the other hand, SVM is more parsimonious and uses less voxels to achieve similar classification accuracies. In conclusion, MLDA is mostly focused on extracting all discriminative information available, while SVM extracts the information which is sufficient for classification. (C) 2009 Elsevier Inc. All rights reserved.