996 resultados para field-amplified stacking injection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

We examine the mean flux across a homogeneous membrane of a charged tracer subject to an alternating, symmetric voltage waveform. The analysis is based on the Nernst-Planck flux equation, with electric field subject to time dependence only. For low frequency electric fields the quasi steady-state flux can be approximated using the Goldman model, which has exact analytical solutions for tracer concentration and flux. No such closed form solutions can be found for arbitrary frequencies, however we find approximations for high frequency. An approximation formula for the average flux at all frequencies is also obtained from the two limiting approximations. Numerical integration of the governing equation is accomplished by use of the numerical method of lines and is performed for four different voltage waveforms. For the different voltage profiles, comparisons are made with the approximate analytical solutions which demonstrates their applicability. (c) 2005 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aims: We evaluated the effect of botulinum toxin type A (BTX-A) injections in the trigone on the antireflux mechanism and evaluated its short-term efficacy. Materials and Methods: Between April and December 2006, 21 patients (10 men and 11 women) were prospectively evaluated. All were incontinent due to refractory NDO and underwent detrusor injection of 300 units of BTX-A, including 50 units into the trigone. Baseline and postoperative evaluation after eight weeks included cystogram, urinary tract ultrasound and urodynamics. Results: At baseline, 20 patients had no vesicoureteral (VUR) and one had grade II unilateral VUR. Postoperative evaluation revealed no cases of de novo VUR and the patient with preinjection VUR had complete resolution of the reflux. Ultrasound showed 5 (23.8%) patients with hydronephrosis before BTX-A injection and only one (4.8%) at the followup evaluation (p=0.066). After treatment, 9 (42.8%) patients became dry, 11 (52.4%) were improved and one (4.8%) had no improvement. Improved patients received antimuscarinic treatment and 8 (38.1%) became dry, with a final total continence rate of 80.1%. Cystometric capacity increased from 271 +/- 92 to 390 +/- 1189 ml (p = 0.002), reflex volume varied from 241 +/- 96 to 323 +/- 201 ml (p = 0.020) and maximum detrusor pressure reduced from 66 +/- 39 to 38 +/- 37 cm H2O (p < 0.001). Conclusions: Our results confirm the safety of trigone injections of BTX-A in terms of development of VUR and upper urinary tract damage. Whether they are beneficial for patients with NDO or other causes of voiding dysfunction will need further studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effect of intra-bone injection of differentiated rat bone marrow mesenchymal stem cells (BMMSCs) into the femur of osteoporotic female rats was studied. Osteoporosis was induced in Wistar female rats by bilateral ovariectomy. Then, 0.75 million BMMSCs isolated from healthy rats were injected into the femurs of osteoporotic rats. Histomorphometric analysis and histology clearly revealed improvements in the treated group as compared to untreated group. In 2 months, the femurs of treated rats, unlike untreated rats, showed trabecular bone percentage almost similar to the femurs from control healthy rats. To confirm the origin of newly formed bone, the experiment was repeated with BMMSCs isolated from green fluorescent protein transgenic rats. Confocal microscopy demonstrated green fluorescent protein-positive cells at the surface of trabecular bone of the treated rats. We investigated in vitro osteogenic differentiation of BMMSCs isolated from osteoporotic rats by studying alkaline phosphatase activity, collagen synthesis, and the ability to form mineralized nodules. Osteoporotic BMMSCs showed less differentiation capabilities as compared to those isolated from healthy rats. The results clearly demonstrated the importance of BMMSCs in osteoporosis and that the disease can be treated by injection of BMMSCs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose The aim of this study was to test the correlation between Fourier-domain (FD) optical coherence tomography (OCT) macular and retinal nerve fibre layer (RNFL) thickness and visual field (VF) loss on standard automated perimetry (SAP) in chiasmal compression. Methods A total of 35 eyes with permanent temporal VF defects and 35 controls underwent SAP and FD-OCT (3D OCT-1000; Topcon Corp.) examinations. Macular thickness measurements were averaged for the central area and for each quadrant and half of that area, whereas RNFL thickness was determined for six sectors around the optic disc. VF loss was estimated in six sectors of the VF and in the central 16 test points in the VF. The correlation between VF loss and OCT measurements was tested with Spearman`s correlation coefficients and with linear regression analysis. Results Macular and RNFL thickness parameters correlated strongly with SAP VF loss. Correlations were generally stronger between VF loss and quadrantic or hemianopic macular thickness than with sectoral RNFL thickness. For the macular parameters, we observed the strongest correlation between macular thickness in the inferonasal quadrant and VF loss in the superior temporal central quadrant (rho=0.78; P<0.001) whereas for the RNFL parameters the strongest correlation was observed between the superonasal optic disc sector and the central temporal VF defect (rho=0.60; P<0.001).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A sample of 312 heroin users was interviewed on their injection of methadone syrup. Methadone injecting was widespread, with 52% of subjects having injected methadone syrup, 29% in the preceding six months. Males and females were equally likely to report methadone injecting. Forty per cent Of current methadone injectors reported weekly or more frequent methadone injecting over the preceding six months. A history of methadone injecting was;associated with abscesses and infections in injection sites, having been diagnosed with a venous thrombosis and a history of heroin overdose. Current methadone injectors were in poorer general health, had more injection-related symptoms, higher levels of psychological distress, were more likely to have recently passed on used injecting equipment and to have recently committed criminal acts. Implications for the reduction in the prevalence of methadone injecting and associated harm are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction and objectives: Recurrent transplant pyelonephritis (RTP) secondary to vesico-ureteral reflux (VUR) to the transplant kidney (KTx) remains a significant cause of infectious complications with impact on patient and graft outcomes. Our objective was to verify the safety and efficacy of transurethral injection of Durasphere (R) to relieve RTP secondary to VUR after renal transplantation. Patients and methods: Between June 2004 and July 2008, eight patients with RTP (defined as two or more episodes of pyelonephritis after transplantation) and VUR to the KTx were treated with subureteral injections of Durasphere (R). The mean age at surgery was 38.8 +/- 13.8 yr (23-65). The patients were followed regularly every six months. The mean interval between the KTx and the treatment was 76 +/- 74.1 (10-238 months). The mean follow-up was 22.3 +/- 16.1 months (8-57 months). Results: Six patients (75%) were free of pyelonephritis during a mean period of follow-up of 23.2 +/- 17.1 months (8-57 months). Two of them had no VUR and four cases presented with G II VUR (pre-operative G IV three cases and one case G III). In one case, symptomatic recurrent cystitis made a second treatment necessary. This patient remained free of infections for three yr after the first treatment and for 18 months after the second treatment. Of the remaining two patients, one had six episodes of RTP before treatment in a period of three yr and only two episodes after treatment in two yr of follow-up. The last case had a new episode of pyelonephritis five months after treatment. Conclusions: Transurethral injection therapy with Durasphere (R) is a safe and effective minimally invasive treatment option for KTx patients with recurrent RTP. A second treatment seems to be necessary in some cases.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Despite modern reanimation surgical techniques, facial paralysis presents with functional and aesthetic deficits. We evaluated facial symmetry after treating with botulinum toxin the healthy side of the face of 25 patients with long-standing facial paralysis who had previously been treated by surgical methods, with 6 months follow-up. Evaluation consisted of a clinical score, the two subscales of the Facial Disability Index, and surface electromyography. The mean botulinum toxin dose was 38 +/- A 5 U (range = 15-69 U). The clinical score showed significant reduction of asymmetry of 48.4% at 1 month and 16.8% after 6 months. The initial result was a consequence of reduced motion on the treated side combined with better motion on the paralyzed side. At 6 months, the treated side returned to basal scores. The residual effect seen in symmetry was due to an increase (18%) of motion in the paralyzed side. There was a significant decrease in the action potential of muscles on the nonparalyzed side 1 month post injection but completely reverted after 6 months. The Physical Function Index increased, but not significantly. The Social/Well-Being Function Index showed a significant increase at 6 months compared to pretreatment. The proposed treatment improved facial symmetry for up to 6 months. Even after the end of the clinical effect of the drug, the paralyzed side`s clinical score was 18% higher than pretreatment, with an increased quality of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We consider the case of two cavity modes of the electromagnetic field, which are coupled via the action of a parametric amplifier. The fields are allowed to leak from the cavity and homodyne measurement is performed on one of the modes. Because of the correlations between the modes, this leads to a reduction of the variance in a quadrature of the other mode, although no measurement is performed on it directly. We discuss how this relates to the Einstein-Podolky-Rosen Gedankenexperiment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The steady-state resonance fluorescence spectrum of a two-level atom driven by a bichromatic field in a broadband squeezed vacuum is studied. When the carrier frequency of the squeezed vacuum is tuned to the frequency of the central spectral line, anomalous spectral features, such as hole burning and dispersive profiles, can occur at the central line. We show that these features appear for wider, and experimentally more convenient, ranges of the parameters than in the case of monochromatic excitation. ?he absence of a coherent spectral component at the central line makes any experimental attempt to observe these features much easier. We also discuss the general features of the spectrum. When the carrier frequency of the squeezed vacuum is tuned to the first odd or even sidebands, the spectrum is asymmetric and only the sidebands an sensitive to phase. For appropriate choices of the phase the linewidths or only the odd or even sidebands can be reduced. A dressed-stale interpretation is provided.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective. Previously we showed that after intravenous injection a lipidic nanoemulsion concentrates in breast carcinoma tissue and other solid tumors and may carry drugs directed against neoplastic tissues. Use of the nanoemulsion decreases toxicity of the chemotherapeutic agents without decreasing the anticancer action. Currently, the hypothesis was tested whether the nanoemulsion concentrates in breast carcinoma tissue after locoregional injection. Methods. Three different techniques of injection of the nanoemulsion were tested in patients scheduled for surgical treatment: G1 (n=4) into the mammary tissue 5 cm away from the tumor; G2 (n=4) into the peritumoral mammary tissue; G3 (n=6) into the tumoral tissue. The nanoemulsion labeled with radioactive cholesteryl oleate was injected 12 h before surgery; plasma decay of the label was determined from blood samples collected over 24 h and the tissue fragments excised during the surgery were analyzed for radioactivity uptake. Results. Among the three nanoemulsion injection techniques, G3 showed the greatest uptake (data expressed in c.p.m/g of tissue) by the tumor (44,769 +/- 54,749) and by the lymph node (2356 +/- 2966), as well as the greatest concentration in tumor compared to normal tissue (844 +/- 1673). In G1 and G2, uptakes were, respectively, tumor: 60 +/- 71 and 843 +/- 1526; lymph node: 263 +/- 375 and 102 +/- 74; normal tissue: 139 +/- 102 and 217 +/- 413. Conclusions. Therefore, with intralesional injection of the nanoemulsion, a great concentration effect can be achieved. This injection technique may be thus a promising approach for drug-targeting in neoadjuvant chemotherapy in breast cancer treatment. (C) 2008 Published by Elsevier Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The germination of the seeds from the Chesnut tree (Castanospermum australe) has been investigated by the NMR Microimaging at 190 MHz. Conventional H-1 spin-echo and T-1 images reveals some details of black bean seeds vascular structure: a system of small spherical holes and curvelinear pathways.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Stem inoculation of clonally propagated lucerne genotypes was used to assess levels of host species and genotype specialisation in Phytophthora medicaginis. A quantitative assessment of pathogenic aggressiveness of 29 P. medicaginis isolates (from lucerne and chickpea) on 9 different clonally propagated lucerne genotypes revealed no significant difference in aggressiveness between isolates from lucerne and those from chickpea on all of the lucerne genotypes. This supported previous studies which showed that P. medicaginis isolates from lucerne and chickpea were indistinguishable using random amplified polymorphic DNA (RAPD) analysis. Analysis of pathogenic aggressiveness towards individual lucerne genotypes revealed, for the first time, specificity of individual P. medicaginis isolates. This has implications for breeding for resistance to P. medicaginis in lucerne, where screening should be done using the widest range of pathogen specificity obtainable.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conducting dielectric samples are often used in high-resolution experiments at high held. It is shown that significant amplitude and phase distortions of the RF magnetic field may result from perturbations caused by such samples. Theoretical analyses demonstrate the spatial variation of the RF field amplitude and phase across the sample, and comparisons of the effect are made for a variety of sample properties and operating field strengths. Although the effect is highly nonlinear, it tends to increase with increasing field strength, permittivity, conductivity, and sample size. There are cases, however, in which increasing the conductivity of the sample improves the homogeneity of the amplitude of the RF field across the sample at the expense of distorted RF phase. It is important that the perturbation effects be calculated for the experimental conditions used, as they have the potential to reduce the signal-to-noise ratio of NMR experiments and may increase the generation of spurious coherences. The effect of RF-coil geometry on the coherences is also modeled, with the use of homogeneous resonators such as the birdcage design being preferred, Recommendations are made concerning methods of reducing sample-induced perturbations. Experimental high-field imaging and high-resolution studies demonstrate the effect. (C) 1997 Academic Press.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Myocardial infarction remains as a major cause of mortality worldwide and a high rate of survivors develop heart failure as a sequel, resulting in a high morbidity and elevated expenditures for health system resources. We have designed a multicenter trial to test for the efficacy of autologous bone marrow (ABM) mononuclear cell (MC) transplantation in this subgroup of patients. The main hypothesis to be tested is that treated patients will have a significantly higher ejection fraction (EF) improvement after 6 months than controls. Methods: A sample of 300 patients admitted with ST elevation acute myocardial infarction (STEMI) and left ventricle (LV) systolic dysfunction, and submitted to successful mechanical or chemical recanalization of the infarct-related coronary artery will be selected for inclusion and randomized to either treated or control group in a double blind manner. The former group will receive 100 x 106 MC suspended in saline with 5% autologous serum in the culprit vessel, while the latter will receive placebo (saline with 5% autologous serum). Implications: Many phase I/II clinical trials using cell therapy for STEMI have been reported, demonstrating that cell transplantation is safe and may lead to better preserved LV function. Patients with high risk to develop systolic dysfunction have the potential to benefit more. Larger randomized, double blind and controlled trials to test for the efficacy of cell therapies in patients with high risk for developing heart failure are required.