989 resultados para bridge damage detection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

It is well known that long term use of shampoo causes damage to human hair. Although the Lowry method has been widely used to quantify hair damage, it is unsuitable to determine this in the presence of some surfactants and there is no other method proposed in literature. In this work, a different method is used to investigate and compare the hair damage induced by four types of surfactants (including three commercial-grade surfactants) and water. Hair samples were immersed in aqueous solution of surfactants under conditions that resemble a shower (38 °C, constant shaking). These solutions become colored with time of contact with hair and its UV-vis spectra were recorded. For comparison, the amount of extracted proteins from hair by sodium dodecyl sulfate (SDS) and by water were estimated by the Lowry method. Additionally, non-pigmented vs. pigmented hair and also sepia melanin were used to understand the washing solution color and their spectra. The results presented herein show that hair degradation is mostly caused by the extraction of proteins, cuticle fragments and melanin granules from hair fiber. It was found that the intensity of solution color varies with the charge density of the surfactants. Furthermore, the intensity of solution color can be correlated to the amount of proteins quantified by the Lowry method as well as to the degree of hair damage. UV-vis spectrum of hair washing solutions is a simple and straightforward method to quantify and compare hair damages induced by different commercial surfactants.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Resistant hypertension (RHTN) includes patients with controlled blood pressure (BP) (CRHTN) and uncontrolled BP (UCRHTN). In fact, RHTN patients are more likely to have target organ damage (TOD), and resistin, leptin and adiponectin may affect BP control in these subjects. We assessed the relationship between adipokines levels and arterial stiffness, left ventricular hypertrophy (LVH) and microalbuminuria (MA). This cross-sectional study included CRHTN (n=51) and UCRHTN (n=38) patients for evaluating body mass index, ambulatory blood pressure monitoring, plasma adiponectin, leptin and resistin concentrations, pulse wave velocity (PWV), MA and echocardiography. Leptin and resistin levels were higher in UCRHTN, whereas adiponectin levels were lower in this same subgroup. Similarly, arterial stiffness, LVH and MA were higher in UCRHTN subgroup. Adiponectin levels negatively correlated with PWV (r=-0.42, P<0.01), and MA (r=-0.48, P<0.01) only in UCRHTN. Leptin was positively correlated with PWV (r=0.37, P=0.02) in UCRHTN subgroup, whereas resistin was not correlated with TOD in both subgroups. Adiponectin is associated with arterial stiffness and renal injury in UCRHTN patients, whereas leptin is associated with arterial stiffness in the same subgroup. Taken together, our results showed that those adipokines may contribute to vascular and renal damage in UCRHTN patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Monte Carlo track structures (MCTS) simulations have been recognized as useful tools for radiobiological modeling. However, the authors noticed several issues regarding the consistency of reported data. Therefore, in this work, they analyze the impact of various user defined parameters on simulated direct DNA damage yields. In addition, they draw attention to discrepancies in published literature in DNA strand break (SB) yields and selected methodologies. The MCTS code Geant4-DNA was used to compare radial dose profiles in a nanometer-scale region of interest (ROI) for photon sources of varying sizes and energies. Then, electron tracks of 0.28 keV-220 keV were superimposed on a geometric DNA model composed of 2.7 × 10(6) nucleosomes, and SBs were simulated according to four definitions based on energy deposits or energy transfers in DNA strand targets compared to a threshold energy ETH. The SB frequencies and complexities in nucleosomes as a function of incident electron energies were obtained. SBs were classified into higher order clusters such as single and double strand breaks (SSBs and DSBs) based on inter-SB distances and on the number of affected strands. Comparisons of different nonuniform dose distributions lacking charged particle equilibrium may lead to erroneous conclusions regarding the effect of energy on relative biological effectiveness. The energy transfer-based SB definitions give similar SB yields as the one based on energy deposit when ETH ≈ 10.79 eV, but deviate significantly for higher ETH values. Between 30 and 40 nucleosomes/Gy show at least one SB in the ROI. The number of nucleosomes that present a complex damage pattern of more than 2 SBs and the degree of complexity of the damage in these nucleosomes diminish as the incident electron energy increases. DNA damage classification into SSB and DSB is highly dependent on the definitions of these higher order structures and their implementations. The authors' show that, for the four studied models, different yields are expected by up to 54% for SSBs and by up to 32% for DSBs, as a function of the incident electrons energy and of the models being compared. MCTS simulations allow to compare direct DNA damage types and complexities induced by ionizing radiation. However, simulation results depend to a large degree on user-defined parameters, definitions, and algorithms such as: DNA model, dose distribution, SB definition, and the DNA damage clustering algorithm. These interdependencies should be well controlled during the simulations and explicitly reported when comparing results to experiments or calculations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To characterize cumulative joint damage (CJD) patterns in rheumatoid arthritis (RA) and determine their associations with demographic/clinical features and HLA-DRB1 gene polymorphism. Hand and foot radiographs were obtained from 404 patients with RA. CJD patterns were determined by 3 derivations from Sharp/van der Heijde scores, obtained by the mathematical division of scores for hands/feet (Sharp-h/f score), fingers/wrists (Sharp-f/w score), and erosion/space narrowing (Sharp-e/sn score), respectively. DNA and serum were obtained for determination of HLA-DRB1 polymorphism, rheumatoid factor (RF), and anticitrullinated protein antibodies (ACPA). Patients with wrist-dominant CJD pattern were more likely to have severe RA than those with finger-dominant pattern (68.4% vs 46.0%; p = 0.036) as were those with foot-dominant vs hand-dominant CJD pattern (76.5% vs 56.4%; p = 0.044). HLA-DRB1 shared epitope (SE) alleles were associated with erosion-dominant CJD pattern (p = 0.021). Patients with erosion-dominant CJD pattern had higher levels of RF and ACPA than those with space-narrowing-dominant CJD pattern (median RF 71.35 U/ml vs 22.05 U/ml, respectively; p = 0.003; median ACPA 187.9 U/ml vs 143.2 U/ml, respectively; p < 0.001). The majority of triple-positive patients (SE+, RF+, ACPA+) had erosion-dominant CJD pattern (62.3%) while the majority of triple-negative patients (SE-, FR-, ACPA-) had space narrowing-dominant CJD pattern (75%; p = 0.017). ACPA was associated with HLA-DRB1 SE alleles (p < 0.05). Patients with foot-dominant CJD pattern were taller than those with hand-dominant CJD pattern (p = 0.002); those with erosion-dominant CJD pattern had higher weight and body mass index than those with space narrowing-dominant CJD pattern (p = 0.014, p = 0.001). CJD patterns were associated with disease severity, HLA-DRB1 SE status, presence and titer of ACPA and RF, and morphometric features.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rubus niveus Thunb. plant belongs to Rosaceae family and have been used traditionally to treat wounds, burns, inflammation, dysentery, diarrhea and for curing excessive bleeding during menstrual cycle. The present study was undertaken to investigate the in vivo genotoxicity of Rubus niveus aerial parts extract and its possible chemoprotection on doxorubicin (DXR)-induced DNA damage. In parallel, the main phytochemicals constituents in the extract were determined. The animals were exposed to the extract for 24 and 48h, and the doses selected were 500, 1000 and 2000mg/kg b.w. administered by gavage alone or prior to DXR (30mg/kg b.w.) administered by intraperitoneal injection. The endpoints analyzed were DNA damage in bone marrow and peripheral blood cells assessed by the alkaline alkaline (pH>13) comet assay and bone marrow micronucleus test. The results of chemical analysis of the extract showed the presence of tormentic acid, stigmasterol, quercitinglucoronide (miquelianin) and niga-ichigoside F1 as main compounds. Both cytogenetic endpoints analyzed showed that there were no statistically significant differences (p>0.05) between the negative control and the treated groups with the two higher doses of Rubus niveus extract alone, demonstrating absence of genotoxic and mutagenic effects. Aneugenic/clastogenic effect was observed only at 2000mg/kg dose. On the other hand, in the both assays and all tested doses were observed a significant reduction of DNA damage and chromosomal aberrations in all groups co-treated with DXR and extract compared to those which received only DXR. These results indicate that Rubus niveus aerial parts extract did not revealed any genotoxic effect, but presented some aneugenic/clastogenic effect at higher dose; and suggest that it could be a potential adjuvant against development of second malignant neoplasms caused by the cancer chemotherapic DXR.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Oxidative stress and inflammatory processes strongly contribute to pathogenesis in Duchenne muscular dystrophy (DMD). Based on evidence that excess iron may increase oxidative stress and contribute to the inflammatory response, we investigated whether deferoxamine (DFX), a potent iron chelating agent, reduces oxidative stress and inflammation in the diaphragm (DIA) muscle of mdx mice (an experimental model of DMD). Fourteen-day-old mdx mice received daily intraperitoneal injections of DFX at a dose of 150 mg/kg body weight, diluted in saline, for 14 days. C57BL/10 and control mdx mice received daily intraperitoneal injections of saline only, for 14 days. Grip strength was evaluated as a functional measure, and blood samples were collected for biochemical assessment of muscle fiber degeneration. In addition, the DIA muscle was removed and processed for histopathology and Western blotting analysis. In mdx mice, DFX reduced muscle damage and loss of muscle strength. DFX treatment also resulted in a significant reduction of dystrophic inflammatory processes, as indicated by decreases in the inflammatory area and in NF-κB levels. DFX significantly decreased oxidative damage, as shown by lower levels of 4-hydroxynonenal and a reduction in dihydroethidium staining in the DIA muscle of mdx mice. The results of the present study suggest that DFX may be useful in therapeutic strategies to ameliorate dystrophic muscle pathology, possibly via mechanisms involving oxidative and inflammatory pathways.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Neks are serine-threonine kinases that are similar to NIMA, a protein found in Aspergillus nidulans which is essential for cell division. In humans there are eleven Neks which are involved in different biological functions besides the cell cycle control. Nek4 is one of the largest members of the Nek family and has been related to the primary cilia formation and in DNA damage response. However, its substrates and interaction partners are still unknown. In an attempt to better understand the role of Nek4, we performed an interactomics study to find new biological processes in which Nek4 is involved. We also described a novel Nek4 isoform which lacks a region of 46 amino acids derived from an insertion of an Alu sequence and showed the interactomics profile of these two Nek4 proteins. Isoform 1 and isoform 2 of Nek4 were expressed in human cells and after an immunoprecipitation followed by mass spectrometry, 474 interacting proteins were identified for isoform 1 and 149 for isoform 2 of Nek4. About 68% of isoform 2 potential interactors (102 proteins) are common between the two Nek4 isoforms. Our results reinforce Nek4 involvement in the DNA damage response, cilia maintenance and microtubule stabilization, and raise the possibility of new functional contexts, including apoptosis signaling, stress response, translation, protein quality control and, most intriguingly, RNA splicing. We show for the first time an unexpected difference between both Nek4 isoforms in RNA splicing control. Among the interacting partners, we found important proteins such as ANT3, Whirlin, PCNA, 14-3-3ε, SRSF1, SRSF2, SRPK1 and hNRNPs proteins. This study provides new insights into Nek4 functions, identifying new interaction partners and further suggests an interesting difference between isoform 1 and isoform 2 of this kinase. Nek4 isoform 1 may have similar roles compared to other Neks and these roles are not all preserved in isoform 2. Besides, in some processes, both isoforms showed opposite effects, indicating a possible fine controlled regulation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Machado-Joseph disease (SCA3) is the most frequent spinocerebellar ataxia worldwide and characterized by remarkable phenotypic heterogeneity. MRI-based studies in SCA3 focused in the cerebellum and connections, but little is known about cord damage in the disease and its clinical relevance. To evaluate the spinal cord damage in SCA3 through quantitative analysis of MRI scans. A group of 48 patients with SCA3 and 48 age and gender-matched healthy controls underwent MRI on a 3T scanner. We used T1-weighted 3D images to estimate the cervical spinal cord area (CA) and eccentricity (CE) at three C2/C3 levels based on a semi-automatic image segmentation protocol. The scale for assessment and rating of ataxia (SARA) was employed to quantify disease severity. The two groups-SCA3 and controls-were significantly different regarding CA (49.5 ± 7.3 vs 67.2 ± 6.3 mm(2), p < 0.001) and CE values (0.79 ± 0.06 vs 0.75 ± 0.05, p = 0.005). In addition, CA presented a significant correlation with SARA scores in the patient group (p = 0.010). CE was not associated with SARA scores (p = 0.857). In the multiple variable regression, we found that disease duration was the only variable associated with CA (coefficient = -0.629, p = 0.025). SCA3 is characterized by cervical cord atrophy and antero-posterior flattening. In addition, the spinal cord areas did correlate with disease severity. This suggests that quantitative analyses of the spinal cord MRI might be a useful biomarker in SCA3.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We review here the chemistry of reactive oxygen and nitrogen species, their biological sources and targets; particularly, biomolecules implicated in the redox balance of the human blood, and appraise the analytical methods available for their detection and quantification. Those biomolecules are represented by the enzymatic antioxidant defense machinery, whereas coadjutant reducing protection is provided by several low molecular weight molecules. Biomolecules can be injured by RONS yielding a large repertoire of oxidized products, some of which can be taken as biomarkers of oxidative damage. Their reliable determination is of utmost interest for their potentiality in diagnosis, prevention and treatment of maladies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.