940 resultados para X-ray luminescences
Resumo:
In this paper, we give an overview of our studies by static and time-resolved X-ray diffraction of inverse cubic phases and phase transitions in lipids. In 1, we briefly discuss the lyotropic phase behaviour of lipids, focusing attention on non-lamellar structures, and their geometric/topological relationship to fusion processes in lipid membranes. Possible pathways for transitions between different cubic phases are also outlined. In 2, we discuss the effects of hydrostatic pressure on lipid membranes and lipid phase transitions, and describe how the parameters required to predict the pressure dependence of lipid phase transition temperatures can be conveniently measured. We review some earlier results of inverse bicontinuous cubic phases from our laboratory, showing effects such as pressure-induced formation and swelling. In 3, we describe the technique of pressure-jump synchrotron X-ray diffraction. We present results that have been obtained from the lipid system 1:2 dilauroylphosphatidylcholine/lauric acid for cubic-inverse hexagonal, cubic-cubic and lamellar-cubic transitions. The rate of transition was found to increase with the amplitude of the pressure-jump and with increasing temperature. Evidence for intermediate structures occurring transiently during the transitions was also obtained. In 4, we describe an IDL-based 'AXCESS' software package being developed in our laboratory to permit batch processing and analysis of the large X-ray datasets produced by pressure-jump synchrotron experiments. In 5, we present some recent results on the fluid lamellar-Pn3m cubic phase transition of the single-chain lipid 1-monoelaidin, which we have studied both by pressure-jump and temperature-jump X-ray diffraction. Finally, in 6, we give a few indicators of future directions of this research. We anticipate that the most useful technical advance will be the development of pressure-jump apparatus on the microsecond time-scale, which will involve the use of a stack of piezoelectric pressure actuators. The pressure-jump technique is not restricted to lipid phase transitions, but can be used to study a wide range of soft matter transitions, ranging from protein unfolding and DNA unwinding and transitions, to phase transitions in thermotropic liquid crystals, surfactants and block copolymers.
Resumo:
We have investigated the effect of sample hydration on the wide-angle X-ray scattering patterns of amyloid fibrils from two different sources, hen egg white lysozyme (HEWL) and an 11-residue peptide taken from the sequence of transthyretin (TTR105-115). Both samples show an inter-strand reflection at 4.7 Å and an inter-sheet reflection which occurs at 8.8 and 10 Å for TTR105-115 and HEWL fibrils, respectively. The positions, widths, and relative intensities of these reflections are conserved in patterns obtained from dried stalks and hydrated samples over a range of fibril concentrations. In 2D scattering patterns obtained from flow-aligned hydrated samples, the inter-strand and inter-sheet reflections showed, respectively, axial and equatorial alignment relative to the fibril axis, characteristic of the cross-β structure. Our results show that the cross-β structure of the fibrils is not a product of the dehydrating conditions typically employed to produce aligned samples, but is conserved in individual fibrils in hydrated samples under dilute conditions comparable to those associated with other biophysical and spectroscopic techniques. This suggests a structure consisting of a stack of two or more sheets whose interfaces are inaccessible to bulk water.
Resumo:
Reaction of the tridentate ONO Schiff-base ligand 2-hydroxybenzoylhydrazone of 2-hydroxybenzoylhydrazine (H2L) with VO(acac)(2) in ethanol medium produces the oxoethoxovanadium(V) complex [VO(OEt)L] (A), which reacts with pyridine to form [VO(OEt)L center dot(py)] (1). Complex 1 is structurally characterized. It has a distorted octahedral O4N2 coordination environment around the V(V) acceptor center. Both complexes A and 1 in ethanol medium react with neutral monodentate Lewis bases 2-picoline, 3-picoline, 4-picoline, 4-amino pyridine, imidazole, and 4-methyl imidazole, all of which are stronger bases than pyridine, to produce dioxovanadium(V) complexes of general formula BH[VO2L]. Most of these dioxo complexes are structurally characterized, and the complex anion [VO2L](-) is found to possess a distorted square pyramidal structure. When a solution/suspension of a BH[VO2L] complex in an alcohol (ROH) is treated with HCl in the same alcohol, it is converted into the corresponding monooxoalkoxo complex [ O(OR)L], where R comes from the alcohol used as the reaction medium. Both complexes A and 1 produce the 4,4'-bipyridine-bridged binuclear complex [VO(OEt)L](2)(mu-4,4'-bipy) (2), which, to the best of our knowledge, represents the first report of a structurally characterized 4,4'-bipyridine-bridged oxovanadium(V) binuclear complex. Two similar binuclear oxovanadium(V) complexes 3 and 4 are also synthesized and characterized. All these binuclear complexes (2-4), on treatment with base B, produce the corresponding mononuclear dioxovanadium(V) complexes (5-10).
Resumo:
A fully automated procedure to extract and to image local fibre orientation in biological tissues from scanning X-ray diffraction is presented. The preferred chitin fibre orientation in the flow sensing system of crickets is determined with high spatial resolution by applying synchrotron radiation based X-ray microbeam diffraction in conjunction with advanced sample sectioning using a UV micro-laser. The data analysis is based on an automated detection of azimuthal diffraction maxima after 2D convolution filtering (smoothing) of the 2D diffraction patterns. Under the assumption of crystallographic fibre symmetry around the morphological fibre axis, the evaluation method allows mapping the three-dimensional orientation of the fibre axes in space. The resulting two-dimensional maps of the local fibre orientations - together with the complex shape of the flow sensing system - may be useful for a better understanding of the mechanical optimization of such tissues.
Resumo:
The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.
Resumo:
Solvent influences on the crystallization of polymorph and hydrate forms of the nootropic drug piracetam (2-oxo-pyrrolidineacetamide) were investigated from water, methanol, 2-propanol, isobutanol, and nitromethane. Crystal growth profiles of piracetam polymorphs were constructed using time-resolved diffraction snapshots collected for each solvent system. Measurements were performed by in situ energy dispersive X-ray diffraction recorded in Station 16.4 at the synchrotron radiation source (SRS) at Daresbury Laboratory, CCLRC UK. Crystallizations from methanol, 2-propanol, isobutanol, and nitromethane progressed in a similar fashion with the initial formation of form I which then converted relatively quickly to form II with form III being generated upon further cooling. However, considerable differences were observed for the polymorphs lifetime and both the rate and temperature of conversion using the different solvents. The thermodynamically unstable form I was kinetically favored in isobutanol and nitromethane where traces of this polymorph were observed below 10 degrees C. In contrast, the transformation of form II and subsequent growth of form III were inhibited in 2-propanol and nitromethane solutions. Aqueous solutions produced hydrate forms of piracetam which are different from the reported monohydrate; this crystallization evolved through successive generation of transient structures which transformed upon exchange of intramolecular water between the liquid and crystalline phases. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 96:1069-1078, 2007.
Resumo:
This paper describes a method for reconstructing 3D frontier points, contour generators and surfaces of anatomical objects or smooth surfaces from a small number, e. g. 10, of conventional 2D X-ray images. The X-ray images are taken at different viewing directions with full prior knowledge of the X-ray source and sensor configurations. Unlike previous works, we empirically demonstrate that if the viewing directions are uniformly distributed around the object's viewing sphere, then the reconstructed 3D points automatically cluster closely on a highly curved part of the surface and are widely spread on smooth or flat parts. The advantage of this property is that the reconstructed points along a surface or a contour generator are not under-sampled or under-represented because surfaces or contours should be sampled or represented with more densely points where their curvatures are high. The more complex the contour's shape, the greater is the number of points required, but the greater the number of points is automatically generated by the proposed method. Given that the number of viewing directions is fixed and the viewing directions are uniformly distributed, the number and distribution of the reconstructed points depend on the shape or the curvature of the surface regardless of the size of the surface or the size of the object. The technique may be used not only in medicine but also in industrial applications.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.
Resumo:
WThe capillary flow alignment of the thermotropic liquid crystal 4-n-octyl-4′-cyanobiphenyl in the nematic and smectic phases is investigated using time-resolved synchrotron small-angle x-ray scattering. Samples were cooled from the isotropic phase to erase prior orientation. Upon cooling through the nematic phase under Poiseuille flow in a circular capillary, a transition from the alignment of mesogens along the flow direction to the alignment of layers along the flow direction (mesogens perpendicular to flow) appears to occur continuously at the cooling rate applied. The transition is centered on a temperature at which the Leslie viscosity coefficient α3 changes sign. The configuration with layers aligned along the flow direction is also observed in the smectic phase. The transition in the nematic phase on cooling has previously been ascribed to an aligning-nonaligning or tumbling transition. At high flow rates there is evidence for tumbling around an average alignment of layers along the flow direction. At lower flow rates this orientation is more clearly defined. The layer alignment is ascribed to surface-induced ordering propagating into the bulk of the capillary, an observation supported by the parallel alignment of layers observed for a static sample at low temperatures in the nematic phase.
Resumo:
The novel cryptand in/out-3, containing two tripyrrolemethane units briged by three 1,3- diisopropylidenbenzene arms was readily synthesized by a convergent three-step synthesis. It binds fluoride by inclusion with excellent selectivity with respect to a number of other tested anions. The structure of the free receptor and that of its fluoride complex were investigated in solution by NMR spectroscopy. The solid state X-ray structure of the free cryptand 3 was also determined.
Resumo:
A program is provided to determine structural parameters of atoms in or adsorbed on surfaces by refinement of atomistic models towards experimentally determined data generated by the normal incidence X-ray standing wave (NIXSW) technique. The method employs a combination of Differential Evolution Genetic Algorithms and Steepest Descent Line Minimisations to provide a fast, reliable and user friendly tool for experimentalists to interpret complex multidimensional NIXSW data sets.
Resumo:
The lithium salt of the anionic SPS pincer ligand composed of a central hypervalent lambda(4)-phosphinine ring bearing two ortho-positioned diphenylphosphine sulfide side arms reacts with [Mn(CO)(5)Br] to give fac-[Mn(SPS)(CO)(3)], This isomer can be converted photochemicaily to mer-[Mn(SPS)(CO)(3)], with a very high quantum yield (0.80 +/- 0.05). The thermal backreaction is slow (taking ca. 8 h at room temperature), in contrast to rapid electrodecatalyzed mer-to-fac isomerization triggered by electrochemical reduction of mer-[Mn(SPS)(CO)(3)]. Both geometric isomers of [Mn(SPS)(CO)(3)] have been characterized by X-ray crystallography. Both isomers show luminescence from a low-lying (IL)-I-3 (SPS-based) excited state. The light emission of fac-[Mn(SPS)(CO)(3)] is largely quenched by the efficient photoisomerization occurring probably from a low-lying Mn-CO dissociative excited state. Density functional theory (DFT) and time-dependent DFT calculations describe the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of fac- and mer-[Mn(CO)(3)(SPS)] as ligand-centered orbitals, largely localized on the phosphinine ring of the SPS pincer ligand. In line with the ligand nature of its frontier orbitals, fac-[Mn(SPS)(CO)(3)] is electrochemically reversibly oxidized and reduced to the corresponding radical cation and anion, respectively. The spectroscopic (electron paramagnetic resonance, IR, and UV-vis) characterization of the radical species provides other evidence for the localization of the redox steps on the SIPS ligand. The smaller HOMO-LUMO energy difference in the case of mer-[Mn(CO)(3)(SPS)], reflected in the electronic absorption and emission spectra, corresponds with its lower oxidation potential compared to that of the fac isomer. The thermodynamic instability of mer-[Mn(CO)(3)(SPS)], confirmed by the DFT calculations, increases upon one-electron reduction and oxidation of the complex.