998 resultados para Sequence Polymorphism
                                
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
                                
Resumo:
Mucosal leishmaniasis (ML) follows localized cutaneous leishmaniasis (CL) caused by Leishmania braziliensis. Proinflammatory responses mediate CL self-healing but are exaggerated in ML Proinflammatory monocyte chemoattractant protein 1 (MCP-1; encoded by CCL2) is associated with CL We explore its role in CL/ML through analysis of the regulatory CCL2 -2518 bp promoter polymorphism in CL/ML population samples and families from Brazil. Genotype frequencies were compared among ML/CL cases and control groups using logistic regression and the family-based association test (FBAT). MCP-1 was measured in plasma and macrophages. The GG recessive genotype at CCL2 -2518 bp was more common in patients with ML (N = 67) than in neighborhood control (NC; N = 60) subjects (OR 1.78; 95% Cl 1.01-3.14; P = 0.045), than in NC combined with leishmanin skin-test positive (N = 60) controls (OR 4.40; 95% CI 1.42-13.65; P = 0.010), and than in controls combined with CL (N = 60) patients (OR 2.78; 95% CI 1.13-6.85; P = 0.045). No associations were observed for CL compared to any groups. FBAT (91 ML and 223 CL cases in families) confirmed recessive association of ML with allele G (Z = 2.679; P = 0.007). Higher levels of MCP-1 occurred in plasma (P = 0.03) and macrophages (P < 0.0001) from GG compared to AA individuals. These results suggest that high MCP-1 increases risk of ML (C) 2010 Elsevier B.V. All rights reserved.
                                
Resumo:
Objective. To evaluate whether the A/G polymorphism at position 2518 in the regulatory region of the monocyte chemoattractant protein-1 (MCP-1) or the V/I polymorphism at position 64 of the receptor. CCR2, are associated with lupus nephritis (LN) or any clinical characteristics of the disease or with renal survival in a patient population. Methods. We selected 197 patients with lupus nephritis and 220 matched healthy controls for study. MCP-1 and CCR2 genotyping was performed by polymerase chain reaction. Clinical and laboratory data were compiled from patients` charts over followup that ranged from 6 months to 10 years. Results. The GIG genotype of MCP-1 was more common in LN patients (p = 0.019), while the A allele was associated with healthy controls (p = 0.007) as was the V allele of CCR2 (p = 0.046) compared to LN patients. Clinical index measures [SLE Disease Activity Index (SLEDAI)], immunological markers, renal histology, renal function at enrollment, and renal survival were not influenced by these polymorphisms. A less aggressive renal disease, measured by renal SLEDAI index, was associated with the V allele of the CCR2 gene polymorphism. Conclusion. These findings support that MCP-1 2518 GIG is associated with LN but there was no association of this genotype with renal function or renal survival. When studying CCR2 64 V/I polymorphism we showed a positive association of the V allele with healthy controls but no association of the genotype with LN patients. (First Release March 152010; J Rheumatol 2010;37:776-82; doi:10.3899/jrheum.090681)
                                
Resumo:
Aims: To evaluate the IL1RN polymorphism as a possible marker for Rheumatic Fever (RF) susceptibility or disease severity. Methods: The genotypes of 84 RF patients (Jones criteria) and 84 normal race-matched controls were determined through the analysis of the number of 86-bp tandem repeats in the second intron of IL1RN. The DNA was extracted from peripheral-blood leukocytes and amplified with specific primers. Clinical manifestations of RF were obtained through a standardized questionnaire and an extensive chart review. Carditis was defined as new onset cardiac murmur that was perceived by a trained physician with corresponding valvae regurgitation or stenosis on echocardiogram. Carditis was classified as severe in the presence of congestive heart failure or upon the indication for cardiac surgery. The statistical association among the genotypes, RF and its clinical variations was determined. Results: The presence of allele I and the genotype A1/A1 were found less frequently among patients with severe carditis when compared to patients without this manifestation (OR = 0.11, p = 0.031; OR = 0.092, p = 0.017). Neither allele I nor allele 2 were associated with the presence of RF (p = 0.188 and p = 0.106), overall carditis (p = 0.578 and p = 0.767), polyarthritis (p = 0.343 and p = 0.313) and chorea (p = 0.654 and p = 0.633). Conclusion: In the Brazilian population, the polymorphism of the IL-1ra gene is a relevant factor for rheumatic heart disease severity. (C) 2009 Elsevier Ltd. All rights reserved.
                                
Resumo:
Background: Forearm blood flow responses during mental stress are greater in individuals homozygous for the Glu27 allele. A high-fat meal is associated with impaired endothelium-dependent dilatation. We investigated the impact of high-fat ingestion on the muscle vasodilatory responses during mental stress in individuals with the Glu27 allele and those with the Gln27 allele of the beta(2)-adrenoceptor gene. Methods: A total of 162 preselected individuals were genotyped for the Glu27Gln beta(2)-adrenoceptor polymorphism. Twenty-four individuals participated in the study. Fourteen were homozygous for the Gln27 allele (Gln27Gln, 40 +/- 2 years; 64 +/- 2 kg), and 10 were homozygous for the Glu27 allele (Glu27Glu, 40 +/- 3 years; 65 +/- 3 kg). Forearm blood flow was evaluated by venous occlusion plethysmography before and after ingestion of 62 g of fat. Results: The high-fat meal caused no changes in baseline forearm vascular conductance (FVC, 2.2 +/- 0.1 vs. 2.4 +/- 0.2; P = 0.27, respectively), but reduced FVC responses to mental stress (1.5 +/- 0.2 vs. 0.8 +/- 0.2 units; P = 0.04). When volunteers were divided according to their genotypes, baseline FVC was not different between groups (Glu27Glu = 2.4 +/- 0.1 vs. Gln27Gln = 2.1 +/- 0.1 units; P = 0.08), but it was significantly greater in Glu27Glu individuals during mental stress (1.9 +/- 0.4 vs. 1.0 +/- 0.3 units; P = 0.04). High-fat intake eliminated the difference in FVC responses between Glu27Glu and Gln27Gln individuals (FVC, 1.3 +/- 0.4 vs. 1.2 +/- 0.4; P = 0.66, respectively). Conclusion: These findings demonstrate that a high-fat meal impairs muscle vasodilatation responses to mental stress in humans. However, this reduction can be attributed to the presence of the homozygous Glu27 allele of the beta(2)-adrenoceptor gene.
                                
Resumo:
Background: The angiotensin-converting enzyme (ACE) insertion/deletion (I/D) polymorphism gene contributes to the genesis of hypertension (HTN) and may help explain the relationship between obstructive sleep apnea (OSA) and HTN. However, ACE is a pleiotropic gene that has several influences, including skeletal muscle and control of ventilation. We therefore tested the hypothesis that ACE polymorphism influences OSA severity. Methods: Male OSA patients (apnea-hypopnea index [AHI] > 5 events/h) from 2 university sleep centers were evaluated by polysomnography and ACE I/D polymorphism genotyping. Results: We studied 266 males with OSA (age = 48 +/- 13y, body mass index = 29 5kg/m(2), AHI = 34 +/- 25events/h). HTN was present in 114 patients (43%) who were older (p < 0.01), heavier (p < 0.05) and had more severe OSA (p < 0.01). The I allele was associated with HTN in patients with mild to moderate OSA (p < 0.01), but not in those with severe OSA. ACE I/D polymorphism was not associated with apnea severity among normotensive patients. In contrast. the only variables independently associated with OSA severity among patients with hypertension in multivariate analysis were BMI (OR = 1.12) and 11 genotype (OR = 0.27). Conclusions: Our results indicate reciprocal interactions between OSA and HTN with ACE I/D polymorphism, suggesting that among hypertensive OSA males, the homozygous ACE I allele protects from severe OSA. (C) 2009 Elsevier B.V. All rights reserved.
                                
Resumo:
The contribution of kinins to the beneficial effects in cardiovascular risk reductions remains unclear. In this context, the present study examined whether the +9bp/-9 bp polymorphism in bradykinin type 2 receptor gene, predicts hypertension risk in a large urban Brazilian population. Our finding indicated that the -9 bp allele may contribute to hypertension because of increased diastolic pressure.
                                
Resumo:
Dias RG, Alves MJ, Pereira AC, Rondon MU, dos Santos MR, Krieger JE, Krieger MH, Negrao CE. Glu298Asp eNOS gene polymorphism causes attenuation in nonexercising muscle vasodilatation. Physiol Genomics 37: 99-107, 2009. First published January 21, 2009; doi:10.1152/physiolgenomics.90368.2008.-The influence of Glu298Asp endothelial nitric oxide synthase (eNOS) polymorphism in exercise-induced reflex muscle vasodilatation is unknown. We hypothesized that nonexercising forearm blood flow (FBF) responses during handgrip isometric exercise would be attenuated in individuals carrying the Asp298 allele. In addition, these responses would be mediated by reduced eNOS function and NO-mediated vasodilatation or sympathetic vasoconstriction. From 287 volunteers previously genotyped, we selected 33 healthy individuals to represent three genotypes: Glu/Glu [n = 15, age 43 +/- 3 yr, body mass index (BMI) 22.9 +/- 0.3 kg/m(2)], Glu/Asp (n = 9, age 41 +/- 3 yr, BMI 23.7 +/- 1.0 kg/m(2)), and Asp/Asp (n = 9, age 40 +/- 4 yr, BMI 23.5 +/- 0.9 kg/m(2)). Heart rate (HR), mean blood pressure (MBP), and FBF (plethysmography) were recorded for 3 min at baseline and 3 min during isometric handgrip exercise. Baseline HR, MBP, FBF, and forearm vascular conductance (FVC) were similar among genotypes. FVC responses to exercise were significantly lower in Asp/Asp when compared with Glu/Asp and Glu/Glu (Delta = 0.07 +/- 0.14 vs. 0.64 +/- 0.20 and 0.57 +/- 0.09 units, respectively; P = 0.002). Further studies showed that intra-arterial infusion of N(G)-monomethyl-L-arginine (L-NMMA) did not change FVC responses to exercise in Asp/Asp, but significantly reduced FVC in Glu/Glu (Delta = 0.79 +/- 0.14 vs. 0.14 +/- 0.09 units). Thus the differences between Glu/Glu and Asp/Asp were no longer observed (P = 0.62). L-NMMA + phentolamine increased similarly FVC responses to exercise in Glu/Glu and Asp/Asp (P = 0.43). MBP and muscle sympathetic nerve activity increased significant and similarly throughout experimental protocols in Glu/Glu and Asp/Asp. Individuals who are homozygous for the Asp298 allele of the eNOS enzyme have attenuated nonexercising muscle vasodilatation in response to exercise. This genotype difference is due to reduced eNOS function and NO-mediated vasodilatation, but not sympathetic vasoconstriction.
                                
Resumo:
Arg72Pro is a common polymorphism in TP53, showing differences in its biological functions. Case-control studies have been performed to elucidate the role of Arg72Pro in cancer, although the results are conflicting and heterogeneous. Here, we analyzed pooled data from case-control studies to determine the role of Arg72Pro in different cancer sites. We performed a systematic review and meta-analysis of 302 case-control studies that analyzed Arg72Pro in cancer susceptibility. Odds ratios were estimated for different tumor sites using distinct genetic models, and the heterogeneity between studies was explored using I(2) values and meta-regression. We adopted quality criteria to classify the studies. Subgroup analyses were done for tumor sites according to ethnicity, histological, and anatomical sites. Results indicated that Arg72Pro is associated with higher susceptibility to cancer in some tumor sites, mainly hepatocarcinoma. For some tumor sites, quality of studies was associated with the size of genetic association, mainly in cervical, head and neck, gastric, and lung cancer. However, study quality did not explain the observed heterogeneity substantially. Meta-regression showed that ethnicity, allelic frequency and genotyping method were responsible for a substantial part of the heterogeneity observed. Our results suggest ethnicity and histological and anatomical sites may modulate the penetrance of Arg72Pro in cancer susceptibility. This meta-analysis denotes the importance for more studies with good quality and that the covariates responsible for heterogeneity should be controlled to obtain a more conclusive response about the function of Arg72Pro in cancer.
                                
Resumo:
Objectives: To validate C/T-13910 polymorphism associated with primary hypolactasia for clinical practice. Design and methods: Lactose breath test and PCR-RFLP for the C/T-13910 polymorphism were performed. Results: Twenty-seven of 28 patients with genotype CC had positive breath tests, all twenty-two patients with genotypes CT or TT had negative breath tests. Agreement of tests was high (p<0.0001; Kappa Index 0.96). Conclusion: C/T-13910 polymorphism detection may be a new tool for primary hypolactasia diagnosis. (C) 2008 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
                                
Resumo:
Background: Using enzyme immunoassays and Western blot (Wb) tests, HTLV serodiagnosis yields indeterminate results in a significant number of cases. Objective: To determine the prevalence of HTLV infection among HTLV-seroindeterminate individuals. Study design: We studied peripheral blood mononuclear cells from 65 anti-HTLV Wb-seroindeterminate individuals by attempting to amplify proviral DNA sequences (tax and pot) to identify HTLV-I and HTLV-2 infections. Results: These 65 specimens exhibited predominantly (43%) anti-HTLV antibodies to gag-coded antigens in the absence of anti-p24 on Wb analysis. Tax proviral sequences were detected in 6 (9.2%) samples. According to restricted fragment polymorphism analysis (RFLP), we identified HTLV-1 proviral DNA in 4 samples. HTLV-2 in one and sequences from both in another. Nested PCR for the pot region was positive in 3 (4.6%) specimens, which were also positive for tax sequences. After hybridization HTLV-1 infection was confirmed in 2 samples (3.1%) and HTLV-2 in another (1.5%). Detection of a single HTLV DNA sequence may be due to infection by defective provirus, but its significance remains undefined. In this cohort, no Wb reactivity pattern was predictive of proviral detection. HTLV-I infection was demonstrated in an individual who had Wb reactivity to gag-coded antigens only. Conclusions: This emphasizes the importance of clinical and laboratory follow-up of HTLV-seroindeterminate individuals from endemic areas. (c) 2009 Elsevier B.V. All rights reserved.
                                
Resumo:
We examined the association between IL28B single-nucleotide polymorphism rs12979860, hepatitis C virus (HCV) kinetic, and pegylated interferon alpha-2a pharmacodynamic parameters in HIV/HCV-coinfected patients from South America. Twenty-six subjects received pegylated interferon alpha-2a + ribavirin. Serum HCV-RNA and interferon concentrations were measured frequently during the first 12 weeks of therapy and analyzed using mathematical models. African Americans and whites had a similar distribution of IL28B genotypes (P = 0.5). The IL28B CC genotype was overrepresented (P = 0.015) in patients infected with HCV genotype-3 compared with genotype-1. In both genotype-1 and genotype-3, the first-phase viral decline and the average pegylated interferon-alpha-2a effectiveness during the first week of therapy were larger (trend P <= 0.12) in genotype-CC compared with genotypes-TC/TT. In genotype-1 patients, the second slower phase of viral decline (days 2-29) and infected cells loss rate, delta, were larger (P = 0.02 and 0.11, respectively) in genotype-CC than in genotypes-TC/TT. These associations were not observed in genotype-3 patients.
                                
Resumo:
Objective To evaluate the influence of CYP17 polymorphism on menopausal symptoms after estrogen treatment. Methods A total of 130 women were recruited, but only 100 of these were selected according to inclusion and exclusion criteria; they were treated with 0.3 mg/day conjugated equine estrogens. One year later, the study was completed by 71 women. The analysis of the Kupperman menopausal index symptoms was made with information provided by the patients on daily diary cards. Blood samples were analyzed and the women were divided into two groups based on the CYP17, 5`-untranslated region: group A (wild-type homozygote and heterozygote) and group B (mutated homozygote). Results The values for the Kupperman menopausal index were similar in both groups at baseline. The symptoms in both groups decreased after 1 year of treatment when compared to those at baseline. The improvement rate was approximately 27.09% and 32.18%, in groups A and B, respectively. The levels of estrogen after treatment were higher in both groups in comparison with the baseline values. The testosterone level rose in group B with the 1-year treatment (0.48 +/- 0.16 ng/ml), reaching a higher level than the level in group A after treatment. The sex hormone binding globulin (SHBG) level showed a significant increase after the 1-year treatment in group B, surpassing both the baseline and the after-treatment values in group A (p < 0.01). Conclusion Our data suggest that the CYP17 polymorphism did not influence the action of estrogen on menopause symptoms during the 1-year treatment. The extra production of estrogen and androgen may have been countered by the elevation of SHBG levels.
                                
Resumo:
Objective To investigate the association between the CYP17 alpha gene polymorphism and hot flushes in postmenopausal women. Methods Ninety-three non-hysterectomized, postmenopausal women were enrolled in this study. Vasomotor symptoms were assessed at the baseline visit and based on information provided by each participant. The genotypic polymorphism of CYP17 alpha gene was analyzed by PCR-RFLP assay using genomic DNA isolated from peripheral blood lymphocytes. Results Thirty-six women reported hot flushes of mild intensity, 25 reported hot flushes of moderate intensity and 32 of severe intensity. There was no significant difference between the severity of hot flushes and the CYP17 genotype or allele frequencies, 0.58 and 0.67 respectively. No association was found between hot flush severity and the CYP17 allele (odds ratio = 1.17, p = 0.61). Conclusion The results of this study suggest that the CYP17 MspAI polymorphism was not significantly associated with an increased risk of reporting hot flushes. At the World Congress on Menopause in Madrid, May 2008, Dr Massad-Costa was awarded the Robert Greenblatt Prize for Basic Science for the study reported in this paper.
                                
Resumo:
Background: Risperidone (RSP) is a benzisoxazole antipsychotic agent used to treat schizophrenia and other psychiatric illnesses in adults and children (including those with autism). After oral administration, RSP is completely absorbed from the gastrointestinal tract and undergoes hydroxylation to yield 9-hydroxyrisperidone (9-OH-RSP), an active metabolite that has a pharmacologic profile and potency similar to RSP. Objectives: The aims of this study were to compare the relative bioavailability of a pharmaceutical-equivalent (test) formulation with a reference formulation of oral RSP 2 mg, both available commercially on the Brazilian pharmaceutical market, and to generate data regarding the oral bioavailability of the tested drug in healthy Brazilian volunteers. Methods: This single-dose, randomized-sequence, open-label, 2-period crossover study was conducted in healthy Brazilian volunteers from August to December 2008. Subjects were randomly assigned to receive the test formulation followed by the reference formulation or vice versa, with a 30-day washout period between doses. Study drugs were administered after a 12-hour overnight fast. For pharmacokinetic analysis, blood samples were drawn at 0 (baseline), 0.25, 0.5, 1, 1.5, 3, 5, 8, 12, 24, 48, 72, 96, and 120 hours after administration. Plasma concentrations of RSP and 9-OH-RSP were determined using LC-MS/MS. The test and reference formulations were to be considered bioequivalent if the 90% CIs for the geometric mean test/reference ratios were within a predetermined range of 80% to 125%, in accordance with the policies of the Brazilian Sanitary Surveillance Agency and the US Food and Drug Administration. Tolerability was determined using clinical assessments, monitoring of vital signs, analysis of laboratory test results, and subject interviews regarding adverse events. Results: A total of 22 subjects were enrolled (11 men, 11 women; mean [SD] age, 32 [12] years [range, 18-58 years]; weight, 70.4 [11.9] kg [range, 50-103 kg]; height, 1.67 [0.08] m [range, 1.56-1.80 m]; and body mass index, 25 [4] kg/m(2) [range, 18-29 kg/m(2)]). For RSP, mean (SD) C(max) values were 12.6 (2.7) and 16.0 (2.3) ng/mL for the test and reference formulations, respectively. For 9-OH-RSP, mean C(max) values were 17.8 (1.3) and 21.0 (1.7) ng/mL for the test and reference formulations. The 90% CIs for the mean test/reference ratios for RSP C(max), AUC(0-120), and AUC(0-infinity) were 74% to 82%, 75% to 85%, and 76% to 85%, respectively, and 83% to 87%, 75% to 79%, and 75% to 78% for 9-OH-RSP. The related adverse events (headache, low back pain, drowsiness, standing hypotension, local postvenipuncture ecchymoses, insomnia, nausea, and vomiting) were transient and mild. Conclusions: This single-dose study found that the test and reference formulations of oral RSP 2 mg did not meet the Brazilian and US regulatory criteria for bioequivalence in these fasting, healthy volunteers. The study formulations appeared to be well tolerated. (Clin Ther 2010;32:2106-2115) (C) 2010 Elsevier HS Journals, Inc.
 
                    