Association Between Increased Platelet P-Selectin Expression and Obesity in Patients With Type 2 Diabetes A BARI 2D (Bypass Angioplasty Revascularization Investigation 2 Diabetes) substudy

OBJECTIVE- To determine whether obesity increases platelet reactivity and thrombin activity in patients with type 2 diabetes plus stable coronary artery disease. RESEARCH DESIGN AND METHODS- We assessed platelet reactivity and markers of thrombin generation and activity in 193 patients from nine clinical sites of the Bypass Angioplasty Revascularization Investigation 2 Diabetes (BARI 2D). Blood taken at the time of enrollment was used for assay of the concentration of prothrombin fragment 1.2 (PT1.2, released when prothrombin is activated) and fibrinopeptide A (FPA, released when fibrinogen is cleaved). Platelet activation was identified with the use of flow cytometry in response to 0, 0.2, and 1 mu mol/l adenosine diphosphate (ADP). RESULTS- Concentrations of FPA, PT1.2, and platelet activation in the absence of agonist were low. Greater BMI was associated with higher platelet reactivity in response to 1 mu m ADP as assessed by surface expression of P-selectin (r = 0.29, P < 0.0001) but not reflected by the binding of fibrinogen to activated glycoprotein IIb-IIIa. BMI was not associated with concentrations of FPA or PT1.2. Platelet reactivity correlated negatively with A1C (P < 0.04), was not related to the concentration Of triglycerides in blood, and did not correlate with the concentration of C-reactive peptide. CONCLUSIONS- Among patients enrolled in this substudy of BARI 2D, a greater BMI was associated with higher platelet reactivity at the time of enrollment. Our results suggest that obesity and insulin resistance that accompanies obesity may influence platelet reactivity in patients with type 2 diabetes.

Use of AST platelet ratio index (APRI Score) as an alternative to liver biopsy for treatment indication in chronic hepatitis C

Chronic hepatitis C (CHC) is one of the most important causes of chronic liver disease in the world, potentially resulting in cirrhosis, hepatocellular carcinoma, and the need for liver transplantation. Liver biopsy is currently performed before therapy indication. Although, it is the golden standard there are many reasons to avoid or delay the procedure. APRI Score is an easy, low cost and practice alternative method which was described as an alternative for assessing structural changes in chronic hepatitis C (CHC). The rationale of this study was to observe the accuracy of APRI Score in comparison to liver biopsy in 400 patients divided into two groups of 200 carriers (Validation and Experimental groups respectively) selected at random or according to liver fibrosis staging (METAVIR). The ROC curves showed a concordance among these two methods of 92% and 88.5% when 1.05 was the cut off (F3 and F4), and 87% and 83%, on 0.75 cut offs (F2-F4). The discordance in advanced fibrosis staging (F3 and F4) was only 16 (8%) and 22 (11%) out of 200 patients in the experimental and validation groups, respectively. In 26 (13%) out of 200 patients in the experimental group and 34 (17%) out of 200 patients in the validation group, there was discordance between APRI Score and liver biopsy in moderate and advanced fibrosis (F2-F4). In conclusion APRI is a serological marker that has satisfactory sensitivity and specificity together with a high predictive value and it can be useful either in the absence of a biopsy or to reduce the frequency with which biopsies need to be carried out to monitor the evolution of chronic hepatitis C and the right moment for treatment indication.

Metabolic syndrome features small, apolipoprotein A-I-poor, triglyceride-rich HDL3 particles with defective anti-apoptotic activity

The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Problems associated with spray drying of sugar-rich foods

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Development of a synthetic 7-ketocholesterol- rich emulsion resembling chylomicrons

Lipid emulsions that mimic natural lipoproteins help to understand the metabolism and the constitutional organization of circulating lipids. Chylomicrons synthesised by enterocyte cells usually contain oxysterols such as 7-ketocholesterol (7-KC). Here we describe the development of a 7-KC-containing emulsion as a model for oxisterol-rich chylomicron. Different amounts of 7-KC were used. Emulsion characteristics as effective diameter, lipid saturation with radiolabeled lipids was evaluated. In conclusion, the production of a synthetic 7-KC-rich emulsion resembling hylomicrons was feasible, being a model for in vivo metabolism studies.

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Nitric oxide modulates lipopolysaccharide-induced endothelial platelet endothelial cell adhesion molecule expression via interleukin-10

We have shown previously that nitric oxide (NO) controls platelet endothelial cell adhesion molecule (PECAM-1) expression on both neutrophils and endothelial cells under physiological conditions. Here, the molecular mechanism by which NO regulates lipopolysaccharide (LPS)-induced endothelial PECAM-1 expression and the role of interleukin (IL)-10 on this control was investigated. For this purpose, N-(G)-nitro-L-arginine methyl ester (L-NAME; 20 mg/kg/day for 14 days dissolved in drinking water) was used to inhibit both constitutive (cNOS) and inducible nitric oxide (iNOS) synthase activities in LPS-stimulated Wistar rats (5 mg/kg, intraperitoneally). This treatment resulted in reduced levels of serum NO. Under this condition, circulating levels of IL-10 was enhanced, secreted mainly by circulating lymphocytes, dependent on transcriptional activation, and endothelial PECAM-1 expression was reduced independently on reduced gene synthesis. The connection between NO, IL-10 and PECAM-1 expression was examined by incubating LPS-stimulated (1 mu g/ml) cultured endothelial cells obtained from naive rats with supernatant of LPS-stimulated lymphocytes, which were obtained from blood of control or L-NAME-treated rats. Supernatant of LPS-stimulated lymphocytes obtained from L-NAME-treated rats, which contained higher levels of IL-10, reduced LPS-induced PECAM-1 expression by endothelial cells, and this reduction was reversed by adding the anti-IL-10 monoclonal antibody. Therefore, an association between NO, IL-10 and PECAM-1 was found and may represent a novel mechanism by which NO controls endothelial cell functions.

Platelet protease-activated receptor 1 and membrane expression of P-selectin in pulmonary arterial hypertension

Introduction: Pulmonary arterial hypertension (PAH) is frequently associated with thrombotic events, particularly involving the pulmonary microcirculation at sites of vascular injury. We therefore decided to analyse protease-activated receptor 1 (PAR1), a key element in the activation of human platelets by thrombin, in PAH patients in stable clinical condition. Methods: Using flow cytometry, we analyzed platelet PAR1 density, PAR1-mediated exposure of P-selectin and the formation of platelet-leukocyte aggregates in 30 PAH patients aged 11 to 78 years (median 50.5 years). The control group consisted of 25 healthy subjects with the same age range as patients. Results: In patients, total platelet PAR1 density and uncleaved PAR1 density correlated negatively with platelet count (r(2) = 0.33 and r(2) = 0.34 respectively, p < 0.0015). In patients with a low platelet count (<150 x 10(9) platelets/L), both densities were increased relative to controls (82% and 33% respectively, p < 0.05). Thrombin peptide-induced platelet exposure of P-selectin was directly related to total and uncleaved PAR1 density (respectively, r(2) = 0.33 and r(2) = 0.29, p < 0.0025) and increased in subjects with low platelet count (46% versus those with normal platelet count, p < 0.05). Patients with low platelet count had decreased in vitro thrombin-induced formation of platelet-leukocyte aggregates (57% decrease versus controls, p < 0.05). Conclusions: There seems to be a subpopulation of PAH patients with increased propensity to thrombotic events as suggested by increased platelet PAR1 expression and PAR-mediated surface exposure of P-selectin associated with decreased platelet count. (C) 2009 Elsevier Ltd. All rights reserved.

Ticagrelor vs. clopidogrel in patients with acute coronary syndromes and diabetes: a substudy from the PLATelet inhibition and patient Outcomes (PLATO) trial

Patients with diabetes mellitus (DM) have high platelet reactivity and are at increased risk of ischaemic events and bleeding post-acute coronary syndromes (ACS). In the PLATelet inhibition and patient Outcomes (PLATO) trial, ticagrelor reduced the primary composite endpoint of cardiovascular death, myocardial infarction, or stroke, but with similar rates of major bleeding compared with clopidogrel. We aimed to investigate the outcome with ticagrelor vs. clopidogrel in patients with DM or poor glycaemic control. We analysed patients with pre-existing DM (n = 4662), including 1036 patients on insulin, those without DM (n = 13 951), and subgroups based on admission levels of haemoglobin A1c (HbA1c; n = 15 150). In patients with DM, the reduction in the primary composite endpoint (HR: 0.88, 95% CI: 0.76-1.03), all-cause mortality (HR: 0.82, 95% CI: 0.66-1.01), and stent thrombosis (HR: 0.65, 95% CI: 0.36-1.17) with no increase in major bleeding (HR: 0.95, 95% CI: 0.81-1.12) with ticagrelor was consistent with the overall cohort and without significant diabetes status-by-treatment interactions. There was no heterogeneity between patients with or without ongoing insulin treatment. Ticagrelor reduced the primary endpoint, all-cause mortality, and stent thrombosis in patients with HbA1c above the median (HR: 0.80, 95% CI: 0.70-0.91; HR: 0.78, 95% CI: 0.65-0.93; and HR: 0.62, 95% CI: 0.39-1.00, respectively) with similar bleeding rates (HR: 0.98, 95% CI: 0.86-1.12). Ticagrelor, when compared with clopidogrel, reduced ischaemic events in ACS patients irrespective of diabetic status and glycaemic control, without an increase in major bleeding events.

Effect of the Novel Thienopyridine Prasugrel Compared With Clopidogrel on Spontaneous and Procedural Myocardial Infarction in the Trial to Assess Improvement in Therapeutic Outcomes by Optimizing Platelet Inhibition With Prasugrel-Thrombolysis in Myocardial Infarction 38 An Application of the Classification System From the Universal Definition of Myocardial Infarction

Background-Prasugrel is a novel thienopyridine that reduces new or recurrent myocardial infarctions (MIs) compared with clopidogrel in patients with acute coronary syndrome undergoing percutaneous coronary intervention. This effect must be balanced against an increased bleeding risk. We aimed to characterize the effect of prasugrel with respect to the type, size, and timing of MI using the universal classification of MI. Methods and Results-We studied 13 608 patients with acute coronary syndrome undergoing percutaneous coronary intervention randomized to prasugrel or clopidogrel and treated for 6 to 15 months in the Trial to Assess Improvement in Therapeutic Outcomes by Optimizing Platelet Inhibition With Prasugrel-Thrombolysis in Myocardial Infarction (TRITON-TIMI 38). Each MI underwent supplemental classification as spontaneous, secondary, or sudden cardiac death (types 1, 2, and 3) or procedure related (Types 4 and 5) and examined events occurring early and after 30 days. Prasugrel significantly reduced the overall risk of MI (7.4% versus 9.7%; hazard ratio [HR], 0.76; 95% confidence interval [CI], 0.67 to 0.85; P < 0.0001). This benefit was present for procedure-related MIs (4.9% versus 6.4%; HR, 0.76; 95% CI, 0.66 to 0.88; P = 0.0002) and nonprocedural (type 1, 2, or 3) MIs (2.8% versus 3.7%; HR, 0.72; 95% CI, 0.59 to 0.88; P = 0.0013) and consistently across MI size, including MIs with a biomarker peak >= 5 times the reference limit (HR. 0.74; 95% CI, 0.64 to 0.86; P = 0.0001). In landmark analyses starting at 30 days, patients treated with prasugrel had a lower risk of any MI (2.9% versus 3.7%; HR, 0.77; P = 0.014), including nonprocedural MI (2.3% versus 3.1%; HR, 0.74; 95% CI, 0.60 to 0.92; P = 0.0069). Conclusion-Treatment with prasugrel compared with clopidogrel for up to 15 months in patients with acute coronary syndrome undergoing percutaneous coronary intervention significantly reduces the risk of MIs that are procedure related and spontaneous and those that are small and large, including new MIs occurring during maintenance therapy. (Circulation. 2009; 119: 2758-2764.)

Genetic heterogeneity in familial acute myelogenous leukemia: Evidence for a second locus at chromosome 16q21-23.2

The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D1GS289, In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The ''repeat expansion detection'' method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.

A semi-empirical approach to optimise the quantity of drying aids required to spray dry sugar-rich foods

A semi-empirical linear equation has been developed to optimise the amount of maltodextrin additive (DE 6) required to successfully spray dry a sugar-rich product on the basis of its composition. Based on spray drying experiments, drying index values for individual sugars (sucrose, glucose, frutose) and citric acid were determined, and us;ng these index values an equation for model mixtures of these components was established. This equation has been tested with two sugar-rich natural products, pineapple juice and honey. The relationship was found to be valid for these products.

Imiquimod 5% Cream for the Treatment of Periocular Basal Cell Carcinoma

Purpose: The objective of this pilot study was to evaluate the efficacy and safety of 5% imiquimod cream in the treatment of periocular basal cell carcinoma (BCC) through the analysis of a case series. Methods: Eight subjects with primary nodular BCC of the eyelid were recruited. Treatment lasted 10 to 16 weeks. The average follow-up time was 11.7 months. Results: Of a total of 10 lesions, 80% resolved clinically and histologically and have remained asymptomatic since. Conclusion: Imiquimod cream 5% was shown to be an attractive alternative to surgical treatment of periocular BCC. Future studies with larger samples and longer follow-up periods are expected to provide more accurate information on the efficacy and safety of the drug.

Metabolism of triglyceride-rich lipoproteins and lipid transfer to high-density lipoprotein in young obese and normal-weight patients with polycystic ovary syndrome

Objective: To clarify whether the metabolism of triglyceride-rich lipoproteins and lipid transfer to high-density lipoprotein (HDL) are altered in patients with polycystic ovary syndrome (PCOS). Design: Case control study. Setting: Endocrinology clinics. Patient(s): Eight normal-weight (NW) and 15 obese (013) patients with PCOS were compared with 10 NW and 10 Ob women without PCOS paired for age and body mass index. Intervention(s): Determination of triglyceride-rich lipoprotein metabolism and lipid transfer to HDL. Main Outcome Measure(s): Participants were injected triglyceride-rich emulsions labeled with (14)C-cholesteryl esters and (3)H-triglycerides and the fractional clearance rate (FCR, in min(-1)) of labels was determined. Lipid transfer from artificial nanoemulsions to HDL was performed by incubating radioactively labeled lipid nanoemulsions with plasma during 1 hour, followed by radioactive counting of HDL-containing supernatant after chemical precipitation. Result(s): Lipolysis estimated by triglyceride FCR was equal in PCOS groups (NW = 0.043 +/- 0.032, Ob = 0.033 +/- 0.009) and respective controls (NW = 0.039 +/- 0.015, Ob = 0.044 +/- 0.019). However, the remnant removal as estimated by cholesteryl ester FCR was reduced in both PCOS groups (NW = 0.005 +/- 0.006, Ob = 0.005 +/- 0.005) compared with controls (NW = 0.016 +/- 0.006, Ob = 0.011 +/- 0.072). Lipid transfer rates were not different among groups, but triglyceride transfer rates were positively correlated with homeostasis model assessment estimate of insulin resistance in PCOS. Conclusion(s): PCOS patients showed decreased removal of atherogenic remnants even when fasting glucose was <100 mg/dL. This reinforces the usefulness of the measures taken to prevent cardiovascular events in PCOS patients. (Fertil Steril (R) 2010;93:1948-56. (C)2010 by American Society for Reproductive Medicine.)