968 resultados para MACROPHAGE ACTIVATION PHENOTYPE
Resumo:
Mutations in the whn gene are associated with the phenotype of congenital athymia and hairlessness in mouse and rat. The whn gene encodes a presumptive transcription factor with a DNA binding domain of the forkhead/ winged-helix class. Two previously described null alleles encode truncated whn proteins lacking the characteristic DNA binding domain. In the rat rnu allele described here, a nonsense mutation in exon 8 of the whn gene was identified. The truncated whnrnu protein contains the DNA binding domain but lacks the 175 C-terminal amino acids of the wild-type protein. To facilitate the identification of functionally important regions in this region, a whn homolog from the pufferfish Fugu rubripes was isolated. Comparison of derived protein sequences with the mouse whn gene revealed the presence of a conserved acidic protein domain in the C terminus, in addition to the highly conserved DNA binding domain. Using fusions with a heterologous DNA binding domain, a strong transcriptional activation domain was localized to the C-terminal cluster of acidic amino acids. As the whnrnu mutant protein lacks this domain, our results indicate that a transactivation function is essential for the activity of the whn transcription factor.
Resumo:
Developmentally regulated genes in Drosophila, which are conserved through evolution, are potential candidates for key functions in biological processes such as cell cycle, programmed cell death, and cancer. We report cloning and characterization of the human homologue of the Drosophila seven in absentia gene (HUMSIAH), which codes for a 282 amino acids putative zinc finger protein. HUMSIAH is localized on human chromosome 16q12-q13. This gene is activated during the physiological program of cell death in the intestinal epithelium. Moreover, human cancer-derived cells selected for suppression of their tumorigenic phenotype exhibit constitutively elevated levels of HUMSIAH mRNA. A similar pattern of expression is also displayed by the p21waf1. These results suggest that mammalian seven in absentia gene, which is a target for activation by p53, may play a role in apoptosis and tumor suppression.
Resumo:
A novel Saccharomyces cerevisiae mutant, unable to grow in the presence of 12.5 mM EGTA, was isolated by replica plating. The phenotype of the mutant is caused by a single amino acid change (Gly149 to Arg) in the essential yeast gene CDC1. The mutant could be suppressed by overexpression of the SMF1 gene, which was isolated as an extragenic high-copy suppressor. The SMF1 gene codes for a highly hydrophobic protein and its deletion renders the yeast cells sensitive to low manganese concentration. In accordance with this observation, the smf1 null mutant exhibits reduced Mn2+ uptake at micromolar concentrations. Using a specific antibody, we demonstrated that Smf1p is located in the yeast plasma membrane. These results suggest that Smf1p is involved in high-affinity Mn2+ uptake. This assumption was also tested by overexpressing the SMF1 gene in the temperature-sensitive mutant of the mitochondrial processing peptidase (MAS1). SMF1 overexpression as well as addition of 1 mM Mn2+ to the growth medium complemented this mutation. This also suggests that in vivo Mas1p is a manganese-dependent peptidase. The yeast Smf1p resembles a protein from Drosophila and mammalian macrophages. The latter was implicated in conferring resistance to mycobacteria. A connection between Mn2+ transport and resistance or sensitivity to mycobacteria is discussed.
Resumo:
The c-rel protooncogene encodes a subunit of the NF-kappa B-like family of transcription factors. Mice lacking Rel are defective in mitogenic activation of B and T lymphocytes and display impaired humoral immunity. In an attempt to identify changes in gene expression that accompany the T-cell stimulation defects associated with the loss of Rel, we have examined the expression of cell surface activation markers and cytokine production in mitogen-stimulated Rel-/- T cells. The expression of cell surface markers including the interleukin 2 receptor alpha (IL-2R alpha) chain (CD25), CD69 and L-selectin (CD62) is normal in mitogen-activated Rel-/- T cells, but cytokine production is impaired. In Rel-/- splenic T cell cultures stimulated with phorbol 12-myristate 13-acetate and ionomycin, the levels of IL-3, IL-5, granulocyte- macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor alpha (TNF-alpha), and gamma interferon (IFN-gamma) were only 2- to 3-fold lower compared with normal T cells. In contrast, anti-CD3 and anti-CD28 stimulated Rel-/- T cells, which fail to proliferate, make little or no detectable cytokines. Exogenous IL-2, which restitutes the proliferative response of the anti-CD3- and anti-CD28-treated Rel-/- T cells, restores production of IL-5, TNF-alpha, and IFN-gamma, but not IL-3 and GM-CSF expression to approximately normal levels. In contrast to mitogen-activated Rel-/- T cells, lipopolysaccharide-stimulated Rel-/- macrophages produce higher than normal levels of GM-CSF. These findings establish that Rel can function as an activator or repressor of gene expression and is required by T lymphocytes for production of IL-3 and GM-CSF.
Resumo:
Activation of macrophages by bacterial lipopolysaccharide (LPS) induces transcription of genes that encode for proinflammatory regulators of the immune response. Previous work has suggested that activation of the transcription factor activator protein 1 (AP-1) is one LPS-induced event that mediates this response. Consistent with this notion, we found that LPS stimulated AP-1-mediated transcription of a transfected reporter gene in the murine macrophage cell line RAW 264.7. As AP-1 activity is regulated in part by activation of the c-Jun N-terminal kinase (JNK), which phosphorylates and subsequently increases the transcriptional activity of c-Jun, we examined whether LPS treatment of macrophages resulted in activation of this kinase. LPS treatment of RAW 264.7 cells, murine bone marrow-derived macrophages, and the human monocyte cell line THP-1 resulted in rapid activation of the p46 and p54 isoforms of JNK. Treatment with wild-type and rough mutant forms of LPS and synthetic lipid A resulted in JNK activation, while pretreatment with the tyrosine kinase inhibitor herbimycin A inhibited this response. Binding of LPS-LPS binding protein (LBP) complexes to CD14, a surface receptor that mediates many LPS responses, was found to be crucial, as pretreatment of THP-1 cells with the monoclonal antibody 60b, which blocks this binding, inhibited JNK activation. These results suggest that LPS activation of JNK in monocyte/macrophage cells is a CD14- and protein tyrosine phosphorylation-dependent event that may mediate the early activation of AP-1 in regulating LPS-triggered gene induction.
Resumo:
The (3;21)(q26;q22) translocation associated with treatment-related myelodysplastic syndrome, treatment-related acute myeloid leukemia, and blast crisis of chronic myeloid leukemia results in the expression of the chimeric genes AML1/EAP, AML1/MDS1, and AML1/EVI1. AML1 (CBFA2), which codes for the alpha subunit of the heterodimeric transcription factor CBF, is also involved in the t(8;21), and the gene coding for the beta subunit (CBFB) is involved in the inv(16). These are two of the most common recurring chromosomal rearrangements in acute myeloid leukemia. CBF corresponds to the murine Pebp2 factor, and CBF binding sites are found in a number of eukaryotic and viral enhancers and promoters. We studied the effects of AML1/EAP and AML1/MDS1 at the AML1 binding site of the CSF1R (macrophage-colony-stimulating factor receptor gene) promoter by using reporter gene assays, and we analyzed the consequences of the expression of both chimeric proteins in an embryonic rat fibroblast cell line (Rat1A) in culture and after injection into athymic nude mice. Unlike AML1, which is an activator of the CSF1R promoter, the chimeric proteins did not transactivate the CSF1R promoter site but acted as inhibitors of AML1 (CBFA2). AML1/EAP and AML1/MDS1 expressed in adherent Rat1A cells decreased contact inhibition of growth, and expression of AML1/MDS1 was associated with acquisition of the ability to grow in suspension culture. Expression of AML1/MDS1 increased the tumorigenicity of Rat1A cells injected into athymic nude mice, whereas AML1/EAP expression prevented tumor growth. These results suggest that expression of AML1/EAP and AML1/MDS1 can interfere with normal AML1 function, and that AML1/MDS1 has tumor-promoting properties in an embryonic rat fibroblast cell line.
Resumo:
Nitric oxide (NO) has been implicated as a pathogenic mediator in a variety of central nervous system (CNS) disease states, including the animal model of multiple sclerosis (MS) and experimental allergic encephalomyelitis. We have examined post-mortem brain tissues collected from patients previously diagnosed with MS, as well as tissues collected from the brains of patients dying without neuropathies. Both Northern blot analysis and reverse transcriptase (RT)-driven in situ PCR (RT-in situ PCR) studies demonstrated that inducible NO synthase (iNOS) mRNA was present in the brain tissues from MS patients but was absent in equivalent tissues from normal controls. We have also performed experiments identifying the cell type responsible for iNOS expression by RT-in situ PCR in combination with immunohistochemistry. Concomitantly, we analyzed the tissues for the presence of the NO reaction product nitrotyrosine to demonstrate the presence of a protein nitrosylation adduct. We report here that iNOS mRNA was detectable in the brains of 100% of the CNS tissues from seven MS patients examined but in none of the three normal brains. RT-in situ PCR experiments also demonstrated the presence of iNOS mRNA in the cytoplasm of cells that also expressed the ligand recognized by the Ricinus communis agglutinin 1 (RCA-1), a monocyte/macrophage lineage marker. Additionally, specific labeling of cells was observed when brain tissues from MS patients were exposed to antisera reactive with nitrotyrosine residues but was significantly less plentiful in brain tissue from patients without CNS disease. These results demonstrate that iNOS, one of the enzymes responsible for the production of NO, is expressed at significant levels in the brains of patients with MS and may contribute to the pathology associated with the disease.
Resumo:
Osteoblasts express calcium channels that are thought to be involved in the transduction of extracellular signals regulating bone metabolism. The molecular identity of the pore-forming subunit (alpha 1) of L-type calcium channel(s) was determined in rat osteosarcoma UMR-106 cells, which express an osteoblast phenotype. A homology-based reverse transcriptase-polymerase chain reaction cloning strategy was employed that used primers spanning the fourth domain. Three types of cDNAs were isolated, corresponding to the alpha 1S (skeletal), alpha 1C (cardiac), and alpha 1D (neuroendocrine) isoforms. In the transmembrane segment IVS3 and the extracellular loop formed by the IVS3-S4 linker, a single pattern of mRNA splicing was found that occurs in all three types of calcium channel transcripts. Northern blot analysis revealed an 8.6-kb mRNA that hybridized to the alpha 1C probe and 4.8- and 11.7-kb mRNAs that hybridized to the alpha 1S and alpha 1D probes. Antisense oligonucleotides directed to the calcium channel alpha 1D transcript, but not those directed to alpha 1S or alpha 1C transcripts, inhibited the rise of intracellular calcium induced by parathyroid hormone. However, alpha 1D antisense oligonucleotides had no effect on the accumulation of cAMP induced by parathyroid hormone. When L-type calcium channels were activated with Bay K 8644, antisense oligonucleotides to each of the three isoforms partially inhibited the rise of intracellular calcium. The present results provide evidence for the expression of three distinct calcium channel alpha 1-subunit isoforms in an osteoblast-like cell line. We conclude that the alpha 1D isoform is selectively activated by parathyroid hormone.
Resumo:
Although both Ras1 and Ras2 activate adenylyl cyclase in yeast, a number of differences can be observed regarding their function in the cAMP pathway. To explore the relative contribution of conserved and variable domains in determining these differences, chimeric RAS1-RAS2 or RAS2-RAS1 genes were constructed by swapping the sequences encoding the variable C-terminal domains. These constructs were expressed in a cdc25ts ras1 ras2 strain. Biochemical data show that the difference in efficacy of adenylyl cyclase activation between the two Ras proteins resides in the highly conserved N-terminal domain. This finding is supported by the observation that Ras2 delta, in which the C-terminal domain of Ras2 has been deleted, is a more potent activator of the yeast adenylyl cyclase than Ras1 delta, in which the C-terminal domain of Ras1 has been deleted. These observations suggest that amino acid residues other than the highly conserved residues of the effector domain within the N terminus may determine the efficiency of functional interaction with adenylyl cyclase. Similar levels of intracellular cAMP were found in Ras1, Ras1-Ras2, Ras1 delta, Ras2, and Ras2-Ras1 strains throughout the growth curve. This was found to result from the higher expression of Ras1 and Ras1-Ras2, which compensate for their lower efficacy in activating adenylyl cyclase. These results suggest that the difference between the Ras1 and the Ras2 phenotype is not due to their different efficacy in activating the cAMP pathway and that the divergent C-terminal domains are responsible for these differences, through interaction with other regulatory elements.
Resumo:
The enzyme collagenase (EC 3.4.24.7), a key mediator in biological remodeling, can be induced in early-passage fibroblasts by a wide variety of agents and conditions. In contrast, at least some primary tissue fibroblasts are incompetent to synthesize collagenase in response to many of these stimulators. In this study, we investigate mechanisms controlling response to two of the conditions in question: (i) trypsin or cytochalasin B, which disrupt actin stress fibers, or (ii) phorbol 12-myristate 13-acetate (PMA), which activates growth factor signaling pathways. We demonstrate that collagenase expression stimulated by trypsin or cytochalasin B is regulated entirely through an autocrine cytokine, interleukin 1 alpha (IL-1 alpha). The IL-1 alpha intermediate also constitutes the major mechanism by which PMA stimulates collagenase expression, although a second signaling pathway(s) contributes to a minor extent. Elevation of the IL-1 alpha level in response to stimulators is found to be sustained by means of an autocrine feedback loop in early-passage fibroblast cultures. In contrast, fibroblasts freshly isolated from the tissue are incompetent to activate and sustain the IL-1 alpha feedback loop, even though they synthesize collagenase in response to exogenous IL-1. We conclude that this is the reason why tissue fibroblasts are limited, in comparison with subcultured fibroblasts, in their capacity to synthesize collagenase. Activation of the IL-1 alpha feedback loop, therefore, seems likely to be an important mechanism by which resident tissue cells adopt the remodeling phenotype.
Resumo:
Murine endothelial cells are readily transformed in a single step by the polyomavirus oncogene encoding middle-sized tumor antigen. These cells (bEND.3) form tumors (hemangiomas) in mice which are lethal in newborn animals. The bEND.3 cells rapidly proliferate in culture and express little or no thrombospondin 1 (TS1). To determine the role of TS1 in regulation of endothelial cell phenotype, we stably transfected bEND.3 cells with a human TS1 expression vector. The cells expressing human TS1 were readily identified by their altered morphology and exhibited a slower growth rate and lower saturation density than the parental bEND.3 cells. The TS1-expressing cells also formed aligned cords of cells instead of clumps or cysts in Matrigel. Moreover, while the bEND.3 cells formed large tumors in nude mice within 48 hr, the TS1-expressing cells failed to form tumors even after 1 month. The TS1-transfected cells expressed transforming growth factor beta mRNA and bioactivity at levels similar to those of the parental or vector-transfected bEND.3 cells, indicating that the effects of TS1 expression are not due to the activation of transforming growth factor beta by TS1. TS1 expression resulted in a > 100-fold decrease in net fibrinolytic (urokinase-type plasminogen activator, uPA) activity due to more plasminogen-activator inhibitor 1 and less uPA secretion. TS1 thus appears to be an important regulator of endothelial cell phenotype required for maintaining the quiescent, differentiated state.
Resumo:
Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
alpha-Melanocyte-stimulating hormone (alpha-MSH) activates the melanocortin-1 receptor (MC1R) on melanocytes to promote a switch from red/yellow pheomelanin synthesis to darker eumelanins via positive coupling to adenylate cyclase. The human MC1R locus is highly polymorphic with the specific variants associated with red hair and fair skin (RHC phenotype) postulated to be loss-of-function receptors. We have examined the ability of MC1R variants to activate the cAMP pathway in stably transfected REK293 cells. The RHC associated variants, Arg151Cys, Arg160Trp and Asp294His, demonstrated agonist-mediated increases in cAMP and phosphorylation of cAMP-responsive element-binding protein (CREB). Whereas the Asp294His variant showed severely impaired functional responses, the Arg151Cys and Arg160Trp variants retained considerable signaling capacity. Melanoma cells homozygous for either the Arg151Cys variant or consensus sequence both elicited CREB phosphorylation in response to alpha-MSH in the presence of IBMX. The common RHC alleles, Arg151Cys, Arg160Trp and Asp294His, are neither complete loss-of-function receptors nor are they functionally equivalent. (c) 2005 Elsevier Inc. All rights reserved.