953 resultados para Immune Function
Resumo:
IL-28 (IFN-λ) cytokines exhibit potent antiviral and antitumor function but their full spectrum of activities remains largely unknown. Recently, IL-28 cytokine family members were found to be profoundly down-regulated in allergic asthma. We now reveal a novel role of IL-28 cytokines in inducing type 1 immunity and protection from allergic airway disease. Treatment of wild-type mice with recombinant or adenovirally expressed IL-28A ameliorated allergic airway disease, suppressed Th2 and Th17 responses and induced IFN-γ. Moreover, abrogation of endogenous IL-28 cytokine function in IL-28Rα(-/-) mice exacerbated allergic airway inflammation by augmenting Th2 and Th17 responses, and IgE levels. Central to IL-28A immunoregulatory activity was its capacity to modulate lung CD11c(+) dendritic cell (DC) function to down-regulate OX40L, up-regulate IL-12p70 and promote Th1 differentiation. Consistently, IL-28A-mediated protection was absent in IFN-γ(-/-) mice or after IL-12 neutralization and could be adoptively transferred by IL-28A-treated CD11c(+) cells. These data demonstrate a critical role of IL-28 cytokines in controlling T cell responses in vivo through the modulation of lung CD11c(+) DC function in experimental allergic asthma. →See accompanying Closeup by Michael R Edwards and Sebastian L Johnston http://dx.doi.org/10.1002/emmm.201100143.
Resumo:
PURPOSE OF REVIEW: Definition of T cell immune correlates in HIV infection remains a lofty goal towards our understanding of the HIV-specific immune response. This review will focus upon recent developments and controversies in our understanding of protective T cell responses against HIV. RECENT FINDINGS: It has become clear that multiple functions and phenotypic markers of T cells must be assessed to accurately characterize the complexity of CD4 and CD8 T cell responses. While evidence indicates that a hallmark of protective immune responses in HIV infection is the presence of 'polyfunctional' T cell responses, a disconnect remains between the function and phenotype of effective HIV-specific T cells. Moreover, there may be inherent differences in the ability of specific human leukocyte antigen class I families to promote CD8 T cell effector versus polyfunctional responses. It remains to be determined how polyfunctional responses arise in HIV infection, which functions are important for control, and whether surface phenotype markers provide an indication of protective capacity. SUMMARY: Polyfunctional and phenotypic assessment of T cell responses have clearly advanced our understanding of HIV specific immune responses. Critical questions remain, however, especially whether polyfunctional T cell responses control, or are controlled by, HIV replication.
Resumo:
Major histocompatibility complex (MHC) molecules are of crucial importance for the immune system to recognize and defend the body against external attacks. Foreign antigens are presented by specialized cells, called antigen presenting cells, to T lymphocytes in the context of MHC molecules, thereby inducing T cell activation. In addition, MHC molecules are essential for Natural Killer (NK) cell biology, playing a role in NK cell education and activation. Recently, the NOD-like receptor (NLR) family member NLRC5 (NLR caspase recruitment domain containing protein 5) was found to act as transcriptional regulator of MHC class I, in particular in T and NK cells. Its role in MHC class I expression is however minor in dendritic cells (DCs). This raised the question of whether inflammatory conditions, which augment the levels of NLRC5 in DCs, could increase its contribution to MHC class I expression. Our work shows that MHC class I transcript and intracellular levels depend on NLRC5, while its role in MHC class I surface expression is instead negligible. We describe however a general salvage mechanism that enables cells with low intracellular MHC class I levels to nevertheless maintain relatively high MHC class I on the cell surface. In addition, we lack a thorough understanding of NLRC5 target gene specificity and mechanism of action. Our work delineates the unique consensus sequence in MHC class I promoters required for NLRC5 recruitment and pinpoints conserved features conferring its specificity. Furthermore, through genome-wide analyses, we confirm that NLRC5 regulates classical MHC class I genes and identify novel target genes all encoding non-classical MHC class I molecules exerting an array of functions in immunity and tolerance. We finally asked why a dedicated factor co-regulates MHC class I expression specifically in T and NK lymphocytes. We show that deregulated NLRC5 expression affects the education of NK cells and alters the crosstalk between T and NK cells, leading to NK cell-mediated killing of T lymphocytes. Altogether this thesis work brings insights into molecular and physiological aspects of NLRC5 function, which might help understand certain aspects of immune responses and disorders. -- Les molécules du complexe majeur d'histocompatibilité (CMH) sont essentielles au système immunitaire pour l'initiation de la réponse immunitaire. En effet, l'activation des lymphocytes T nécessite la reconnaissance d'un antigène étranger présenté par les cellules présentatrices d'antigènes sur une molécule du CMH. Les molécules du CMH ont également un rôle fondamental pour la fonction des cellules Natural Killer (NK) puisqu'elles sont nécessaires à leur processus d'éducation et d'activation. Récemment, NLRC5 (NLR caspase recruitment domain containing protein 5), un membre de la famille des récepteurs de type NOD (NLRs), a été décrit comme un facteur de transactivation de l'expression des gènes du CMH de classe I. A l'état basai, cette fonction transcriptionnelle est essentielle dans les lymphocytes T et NK, alors que ce rôle reste mineur pour l'expression des molécules du CMH de classe I dans les cellules dendritiques (DCs). Dans des conditions inflammatoires, l'expression de NLRC5 augmente dans les DCs. Notre travail démontre que, dans ces conditions, les transcrits et les niveaux intracellulaires des molécules du CMH de classe I augmentent aussi d'une façon dépendante de NLRC5. A contrario, le rôle de NLRC5 sur les niveaux de molécules de surface reste minoritaire. Cette observation nous a conduits à l'identification d'un mécanisme général de compensation qui permet aux cellules de maintenir des niveaux relativement élevés de molécules de CMH de class I à leur surface malgré de faibles niveaux intracellulaires. De plus, il semblait nécessaire de s'orienter vers une approche plus globale afin de déterminer l'étendue de la fonction transcriptionnelle de NLRC5. Par une approche du génome entier, nous avons pu décrire une séquence consensus conservée présente dans les promoteurs des gènes du CMH de classe I, sur laquelle NLRC5 est spécifiquement recruté. Nous avons pu également identifier de nouveaux gènes cibles codant pour des molécules de CMH de classe I non classiques impliqués dans l'immunité et la tolérance. Finalement, nous nous sommes demandé quel est l'intérêt d'avoir un facteur transcriptionnel, en l'occurrence NLRC5, qui orchestre l'expression du CMH de classe I dans les lymphocytes T et NK. Nous montrons que la dérégulation de l'expression de NLRC5 affecte l'éducation des cellules NK et conduit à la mort cellulaire des lymphocytes T médiée par les cellules NK. Dans l'ensemble ce travail de thèse contribue à la caractérisation du rôle de NLRC5, tant au niveau moléculaire que physiologique, ce qui présente un intérêt dans le cadre de la compréhension de certains aspects physiopathologique de la réponse immunitaire.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Background: There is little information about the relation between the fatty acid composition of human immune cells and the function of those cells over the habitual range of fatty acid intakes. Objective: The objective of the study was to determine the relation between the fatty acid composition of human peripheral blood mononuclear cell (PBMC) phospholipids and the functions of human immune cells. Design: One hundred fifty healthy adult subjects provided a fasting blood sample. The phagocytic and oxidative burst activities of monocytes and neutrophils were measured in whole blood. PBMCs were isolated and used to measure lymphocyte proliferation in response to the T cell mitogen concanavalin A and the production of cytokines in response to concanavalin A or bacterial lipopolysaccharide. The fatty acid composition of plasma and PBMC phospholipids was determined. Results: Wide variations in fatty acid composition of PBMC phospholipids and immune cell functions were identified among the subjects. The proportions of total Polyunsaturated fatty acids (PUFAs), of total n-6 and n-3 PUFAs, and of several individual PUFAs in PBMC phospholipids were positively correlated with phagocytosis by neutrophils and monocytes, neutrophil oxidative burst, lymphocyte proliferation, and interferon gamma production. The ratios of saturated fatty acids to PUFAs and of n-6 to n-3 PUFAs were negatively correlated with these same immune functions. The relation of PBMC fatty acid composition to monocyte oxidative burst was the reverse of its relation to monocyte phagocytosis and neutrophil oxidative burst. Conclusion: Variations in the fatty acid composition of PBMC phospholipids account for some of the variability in immune cell functions among healthy adults.
Resumo:
The temporal organization of mammals presents a daily adjustment to the environmental light/dark cycle. The environmental light detected by the retina adjusts the central clock in the suprachiasmatic nuclei, which innervate the pineal gland through a polysynaptic pathway. During the night, this gland produces and releases the nocturnal hormone melatonin, which circulates throughout the whole body and adjusts several bodily functions according to the existence and duration of darkness. We have previously shown that during the time frame of an inflammatory response, pro-inflammatory cytokines, such as tumor necrosis factor-a, inhibit while anti-inflammatory mediators, such as glucocorticoids, enhance the synthesis of melatonin, interfering in the daily adjustment of the light/dark cycle. Therefore, injury disconnects the organism from environmental cycling, while recovery restores the light/dark information to the whole organism. Here, we extend these observations by evaluating the effect of a mild restraint stress, which did not induce macroscopic gastric lesions. After 2 h of restraint, there was an increase in circulating corticosterone, indicating activation of the hypothalamus-pituitary-adrenal (HPA) axis. In parallel, an increase in melatonin production was observed. Taking into account the data obtained with models of inflammation and stress, we reinforce the hypothesis that the activity of the pineal gland is modulated by the state of the immune system and the HPA axis, implicating the darkness hormone melatonin as a modulator of defense responses.
Resumo:
Matrix metalloproteinases are the components of the tumour microenvironment which play a crucial role in tumour progression. Matrix metalloproteinase-7 (MMP-7) is expressed in a variety of tumours and the expression is associated with an aggressive malignant phenotype and poor prognosis. A role for MMP-7 in the immune escape of tumours has been postulated, but the mechanisms are not clearly understood. The present study was focused on identifying physiological inactivators of MMP-7 and also to unravel the mechanisms involved in MMP-7 mediated immune escape. This study shows that human leukocyte elastase (HLE), secreted by polymorphonuclear leukocytes cleaves MMP-7 in the catalytic domain as revealed by N-terminal sequencing. Further analysis demonstrates that the activity of MMP-7 was drastically decreased after HLE treatment in a time and dose dependent manner. MMP-7 induces apoptosis resistance in tumour cells by cleaving CD95 and CD95L. The effect of HLE on MMP-7 mediated apoptosis resistance was analysed. In vitro stimulation of apoptosis by anti-Apo-1 (anti-CD95 antibody) and the chemotherapeutic drug doxorubicin is reduced by MMP-7. Also tumour specific cytotoxic T cells do not effectively kill tumour cells in the presence of MMP-7. This study revealed that HLE abrogates the negative effect of MMP-7 on apoptosis induced by CD95 stimulation, doxorubicin or cytotoxic T cells and restores apoptosis sensitivity of tumour cells. To gain insight into the possible immune modulatory functions of MMP-7, experiments were performed to identify new immune relevant substrates. The human T cell line, Jurkat, was selected for these studies. Hsc70 which is involved in uncoating of clathrin vesicles was found in the supernatants of the MMP-7 treated cells indicating a modulatory role of MMP-7 on endocytosis. Further studies demonstrated that MMP-7 leads to decreased clathrin staining in HEK293, HepG2, Jurkat, CD4+ T cells and dendritic cells. Results also show MMP-7 treatment increased surface expression of cytotoxic T lymphocyte associated protein-4 (CTLA-4) which accumulated due to inhibition of the clathrin mediated internalization in CD4+CD25+ cells.
Resumo:
This thesis focuses on different aspects of immune regulation, both at the cellular and molecular levels. More specifically, this work concentrates on the importance of Interleukin-10, B and T Lymphocyte Attenuator (BTLA), and dendritic cells in respect to immune regulation, with special emphasis on autoimmunity. In this thesis, we show that the cellular source of IL10 production can dramatically influence the outcome of an autoimmune response. We show that T cell-derived IL10 plays an important role in controlling the viability of recently activated T cells, allowing them to become fully functional T effector cells. T cell-specific IL10-deficient mice failed to induce EAE when immunized with MOG peptide. Furthermore, when re-challenged with MOG or other stimuli, these T cells exhibited increased apoptosis rates. Here we report for the first time the generation of a novel mouse model that allows the conditional over-expression of BTLA. We show that BTLA can negatively regulate CD4+ T cells responses, when expressed by the T cells themselves. BTLA over-expression by CD8+ T cells or dendritic cells, however, resulted in enhanced viral clearance. In this study, we show that depletion of DCs, either early on from birth or later in adulthood, does not prevent EAE induction, but instead leads to a lower state of tolerance and stronger immune response. We also show that DCs are responsible for the upregulation of PD-1 on antigen-specific T cells and subsequently induce the formation of Tregs during immune responses.
Resumo:
The production of immunoglobulin A (IgA) in mammals exceeds all other isotypes, and it is mostly exported across mucous membranes. The discovery of IgA and the realization that it dominates humoral mucosal immunity, in contrast to the IgG dominance of the systemic immune system, was early evidence for the distinct nature of mucosal immunology. It is now clear that IgA can function in high-affinity modes for neutralization of toxins and pathogenic microbes, and as a low-affinity system to contain the dense commensal microbiota within the intestinal lumen. The basic map of induction of IgA B cells in the Peyer's patches, which then circulate through the lymph and bloodstream to seed the mucosa with precursors of plasma cells that produce dimeric IgA for export through the intestinal epithelium, has been known for more than 30 years. In this review, we discuss the mechanisms underlying selective IgA induction of mucosal B cells for IgA production and the immune geography of their homing characteristics. We also review the functionality of secretory IgA directed against both commensal organisms and pathogens.
Resumo:
Ticks are blood-feeding arthropods that secrete immunomodulatory molecules through their saliva to antagonize host inflammatory and immune responses. As dendritic cells (DCs) play a major role in host immune responses, we studied the effects of Rhipicephalus sanguineus tick saliva on DC migration and function. Bone marrow-derived immature DCs pre-exposed to tick saliva showed reduced migration towards macrophage inflammatory protein (MIP)-1 alpha, MIP-1 beta and regulated upon activation, normal T cell expressed and secreted (RANTES) chemokines in a Boyden microchamber assay. This inhibition was mediated by saliva which significantly reduced the percentage and the average cell-surface expression of CC chemokine receptor CCR5. In contrast, saliva did not alter migration of DCs towards MIP-3 beta, not even if the cells were induced for maturation. Next, we evaluated the effect of tick saliva on the activity of chemokines related to DC migration and showed that tick saliva per se inhibits the chemotactic function of MIP-1 alpha, while it did not affect RANTES, MIP-1 beta and MIP-3 beta. These data suggest that saliva possibly reduces immature DC migration, while mature DC chemotaxis remains unaffected. In support of this, we have analyzed the percentage of DCs on mice 48 h after intradermal inoculation with saliva and found that the DC turnover in the skin was reduced compared with controls. Finally, to test the biological activity of the saliva-exposed DCs, we transferred DCs pre-cultured with saliva and loaded with the keyhole limpet haemocyanin (KLH) antigen to mice and measured their capacity to induce specific T cell cytokines. Data showed that saliva reduced the synthesis of both T helper (Th)1 and Th2 cytokines, suggesting the induction of a non-polarised T cell response. These findings propose that the inhibition of DCs migratory ability and function may be a relevant mechanism used by ticks to subvert the immune response of the host. (c) 2007 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
Resumo:
Control of the acute phase of Trypanosoma cruzi infection is critically dependent on cytokine-mediated macrophage activation to intracellular killing, natural killer (NK) cells, CD4(+) T cells, CD8(+) T cells and B cells. Cell-mediated immunity in T. cruzi infection is also modulated by cytokines, but in addition to parasite-specific responses, autoimmunity can be also triggered. Importantly, cytokines may also play a role in the cell-mediated immunity of infected subjects. Here we studied the role of cytokines in the regulation of innate and adaptive immunity during the acute phase of T. cruzi infection in Wistar rats. Melatonin is an effective regulator of the immune system. Macrophages and T lymphocytes, which have melatonin receptors, are target cells for the immunomodulatory function of melatonin. In this paper melatonin was orally given via two protocols: prior to and concomitant with infection. Both treatments were highly effective against T. cruzi with enhanced action for the concomitant treatment. The data suggest an up-regulation of the TH-1 immune response as all analyzed parameters, interleukin (IL)-4, IL-10, transforming growth factor-beta 1 and splenocyte proliferation, displayed reduced levels as compared with the untreated counterparts. However, the direct effects of melatonin on immune cells have not been fully investigated during T. cruzi infection. We conclude that in light of the current results, melatonin exerted important therapeutic benefits through its immune regulatory effects.
Resumo:
The functional importance of members of the S100 Ca2+-binding protein family is recently emerging. A variety of activities, several of which are apparently opposing, are attributed to S100A8, a protein implicated in embryogenesis, growth, differentiation, and immune and inflammatory processes. Murine (m) S100A8 was initially described as a chemoattractant (CP-10) for myeloid cells. It is coordinately expressed with mS100A9 (MRP14) in neutrophils and the non-covalent heterodimer is presumed to be the functional intracellular species. The extracellular chemotactic activity of mS100A8, however, is not dependent on mS100A9 and occurs at concentrations (10(-13)-10(-11) M) at which the non-covalent heterodimer would probably dissociate. This review focuses on the structure and post-translational modifications of mS100A8/A9 and their effects on function, particularly chemotaxis.
Resumo:
Polydnaviruses are associated with certain parasitoid wasps and are introduced into the body cavity of the host caterpillar during oviposition. Some of the viral genes are expressed in host tissues and corresponding proteins are secreted into the hemocoel causing suppression of the host immune system. The Cotesia rubecula polydnavirus gene product, CrV1, effectively inactivates hemocytes by mediating cytoskeleton break-down. A precondition for the CrV1 function is the incorporation of the extracellular protein by hemocytes. Here, we show that a coiled-coil domain containing a putative leucine zipper is required for CrV1 function, since removal of this domain abolishes binding and uptake of the CrV1 protein by hemocytes. (C) 2002 Elsevier Science Ltd. All rights reserved.
Resumo:
An understanding of the biochemical control of dendritic cell (DC) differentiation/activation is essential for improving T cell immunity by various immunotherapeutic approaches, including DC immunization. Ligation of CD40 enhances DC function, including conditioning for CTL priming. NF-kappaB, and particularly RelB, is an essential control pathway for myeloid DC differentiation. Furthermore, RelB regulates B cell Ag-presenting function. We hypothesized that CD40 ligand (CD40L) and TNF-alpha, which differ in their capacity to condition DC, would also differ in their capacity to activate NF-kappaB. DC differentiated for 2 days from monocytes in the presence of GM-CSF and IL-4 were used as a model, as NF-kappaB activity was constitutively low. The capacity of DC to activate T cells following CD40L treatment was enhanced compared with TNF-alpha treatment, and this was NF-kappaB dependent. Whereas RelB/p50 translocation induced by TNF-alpha was attenuated after 6 h, RelB/p50 nuclear translocation induced by CD40L was sustained for at least 24 h. The mechanism of this difference related to enhanced degradation of IkappaBalpha following CD40L stimulation. However, NF-kappaB activation induced by TNF-alpha could be sustained by blocking autocrine IL-10. These data indicate that NF-kappaB activation is essential for T cell activation by DC, and that this function is enhanced if DC NF-kappaB activation is prolonged. Because IL-10 moderates DC NF-kappaB activation by TNF-alpha, sustained NF-kappaB activation can be achieved by blocking IL-10 in the presence of stimuli that induce TNF-alpha.