989 resultados para (Gtg)5-pcr


Relevância:

30.00% 30.00%

Publicador:

Resumo:

OBJECTIVE: To analyze cytokine gene expression in keratinocytes from patients with systemic lupus erythematosus (SLE). INTRODUCTION: Keratinocytes represent 95% of epidermal cells and can secrete several cytokines. METHODS: Keratinocytes were obtained by laser microdissection from 21 patients with SLE (10 discoid and 11 acute lesions) at involved and uninvolved sites. All patients were receiving a low/moderate prednisone dose and 18 were receiving chloroquine diphosphate. IL-2, IL-5, TNF-α and IFN-γ gene expression was evaluated by real-time PCR and expressed as the ratio (R) to a pool of skin samples from 12 healthy volunteers. RESULTS: Heterogeneity in cytokine gene expression was found among patients with SLE. Eighteen of 38 valid SLE samples (47%) presented overexpression (R>1) of at least one cytokine. Lesional skin samples tended to show higher cytokine expression than samples from uninvolved skin (p = 0.06). IL-5 and IFN-γ were the most commonly overexpressed cytokines. Samples with cytokine overexpression corresponded to more extensive and severe lesions. Prednisone dose did not differ between samples without cytokine overexpression (15.71±3.45 mg/day) and those with overexpressed cytokines (12.68±5.41 mg/day) (p = 0.216). Samples from all patients not receiving diphosphate chloroquine had at least one overexpressed cytokine. CONCLUSIONS: The heterogeneous keratinocyte cytokine gene expression reflects the complex immunological and inflammatory background in SLE. Patients with severe/extensive skin lesions showed a higher frequency of cytokine gene overexpression. Increased IFN-γ and IL-5 expression suggests that Th1 and Th2 cells are involved in SLE skin inflammation. The possibility that prednisone and antimalarial drugs may have contributed to low cytokine gene expression in some samples cannot be ruled out.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

O HCV é um vírus esférico, que apresenta um genoma de RNA com polaridade positiva. Atualmente está classificado na família Flaviviridae num gênero separado que é o Hepacivirus, apresenta cerca de 9,4 Kb constituído por uma única e longa fase de leitura aberta (ORF) que compreende quase todo o genoma. Apresenta duas regiões não traduzidas nas extremidades 5' e 3' denominadas 5' UTR e 3' UTR. A poli proteína precursora é clivada em dez proteínas, resultando em proteínas virais estruturais e proteínas nãoestruturais. É um vírus de transmissão preferencialmente parenteral, com distribuição universal, cujo diagnóstico é feito na grande maioria de maneira acidental, sendo atualmente utilizado os testes sorológico e molecular. Este trabalho tem como objetivo comparar o teste sorológico de imunoensaio enzimático (ELISA) e a reação em cadeia da polimerase (PCR) na ocasião da seleção de pré-doadores de sangue. Foram feitos testes de detecção do vírus C por PCR em 290 amostras com resultado positivo ou indeterminado para o teste ELISA. A análise dos resultados revelou que as amostras com testes ELISA positivo/PCR positivo e ELISA positivo/PCR negativo são duas amostras diferentes e independentes (p=0,0006). Esta diferença pode ser supostamente devido a resposta imune diferenciada nas amostras que apresentaram resultado no teste PCR positivas. Esperava-se que houvesse correlação entre os resultados do DO/Cutoff (ELISA) e carga viral (PCR) como o que ocorre em outros vírus como o HIV, no entanto os resultados apresentaram-se totalmente dispersos (R2=0,025), confirmando a não correlação entre os dois testes: ELISA e PCR para o vírus C.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Dentre as doenças cardiovasculares, a trombose venosa (TV) destaca-se pela associação entre fatores de riscos adquiridos e fatores genéticos. A resistência hereditária à proteína C ativada tem sido identificada como a principal causa dos casos de trombose venosa, sendo frequentemente associada à mutação fator V Leiden (G1694A). Em indivíduos homozigotos, o risco de trombose venosa é 50 a 100 vezes maior que em pacientes homozigotos normais, enquanto em pacientes heterozigotos o risco é de 5 a 10 vezes. Baseado na necessidade de avaliação e acompanhamento de pacientes com casos de trombose venosa e prevenção de seus respectivos familiares, foi desenvolvido um método simples de discriminação alélica do fator V da coagulação utilizando PCR em tempo real. Foram selecionados 67 pacientes com histórico de TV e 51 indivíduos sem histórico de TV. Primeiramente, a discriminação alélica do fator V foi realizada através de PCR convencional seguida de digestão enzimática (Mnl). Posteriormente, o diagnóstico foi realizado por PCR em tempo real. Ambos os métodos foram baseados no polimorfismo G1691A, sendo no segundo utilizado fluoróforos VIC e FAM para marcar os nucleotídeos G e A, respectivamente. A técnica de PCR-RFLP foi utilizada para diagnosticar 95 indivíduos homozigotos normais, 21 heterozigotos e 2 homozigotos FVL. Utilizando PCR em tempo real foram obtidos os mesmos resultados. A máxima similaridade entre os resultados obtidos por PCR em tempo real e PCR-RFLP indicou precisão significativa do novo método de discriminação e visualização alélica do fator V.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Pós-graduação em Microbiologia - IBILCE

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)