999 resultados para adenine-nucleotide concentrations
Resumo:
The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.
Resumo:
CONTEXT: The role and importance of circulating sclerostin is poorly understood. High bone mass (HBM) caused by activating LRP5 mutations has been reported to be associated with increased plasma sclerostin concentrations; whether the same applies to HBM due to other causes is unknown. OBJECTIVE: Our objective was to determine circulating sclerostin concentrations in HBM. DESIGN AND PARTICIPANTS: In this case-control study, 406 HBM index cases were identified by screening dual-energy x-ray absorptiometry (DXA) databases from 4 United Kingdom centers (n = 219 088), excluding significant osteoarthritis/artifact. Controls comprised unaffected relatives and spouses. MAIN MEASURES: Plasma sclerostin; lumbar spine L1, total hip, and total body DXA; and radial and tibial peripheral quantitative computed tomography (subgroup only) were evaluated. RESULTS: Sclerostin concentrations were significantly higher in both LRP5 HBM and non-LRP5 HBM cases compared with controls: mean (SD) 130.1 (61.7) and 88.0 (39.3) vs 66.4 (32.3) pmol/L (both P < .001, which persisted after adjustment for a priori confounders). In combined adjusted analyses of cases and controls, sclerostin concentrations were positively related to all bone parameters found to be increased in HBM cases (ie, L1, total hip, and total body DXA bone mineral density and radial/tibial cortical area, cortical bone mineral density, and trabecular density). Although these relationships were broadly equivalent in HBM cases and controls, there was some evidence that associations between sclerostin and trabecular phenotypes were stronger in HBM cases, particularly for radial trabecular density (interaction P < .01). CONCLUSIONS: Circulating plasma sclerostin concentrations are increased in both LRP5 and non-LRP5 HBM compared with controls. In addition to the general positive relationship between sclerostin and DXA/peripheral quantitative computed tomography parameters, genetic factors predisposing to HBM may contribute to increased sclerostin levels.
Resumo:
The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool `PromPredict'. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.
Resumo:
The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.
Resumo:
Quantification of pyridoxal-5´-phosphate (PLP) in biological samples is challenging due to the presence of endogenous PLP in matrices used for preparation of calibrators and quality control samples (QCs). Hence, we have developed an LC-MS/MS method for accurate and precise measurement of the concentrations of PLP in samples (20 µL) of human whole blood that addresses this issue by using a surrogate matrix and minimizing the matrix effect. We used a surrogate matrix comprising 2% bovine serum albumin (BSA) in phosphate buffer saline (PBS) for making calibrators, QCs and the concentrations were adjusted to include the endogenous PLP concentrations in the surrogate matrix according to the method of standard addition. PLP was separated from the other components of the sample matrix using protein precipitation with trichloroacetic acid 10% w/v. After centrifugation, supernatant were injected directly into the LC-MS/MS system. Calibration curves were linear and recovery was > 92%. QCs were accurate, precise, stable for four freeze-thaw cycles, and following storage at room temperature for 17h or at -80 °C for 3 months. There was no significant matrix effect using 9 different individual human blood samples. Our novel LC-MS/MS method has satisfied all of the criteria specified in the 2012 EMEA guideline on bioanalytical method validation.
Resumo:
Background Breast cancer (BC) is primarily considered a genetic disorder with a complex interplay of factors including age, gender, ethnicity, family history, personal history and lifestyle with associated hormonal and non-hormonal risk factors. The SNP rs2910164 in miR146a (a G to C polymorphism) was previously associated with increased risk of BC in cases with at least a single copy of the C allele in breast cancer, though results in other cancers and populations have shown significant variation. Methods In this study, we examined this SNP in an Australian sporadic breast cancer population of 160 cases and matched controls, with a replicate population of 403 breast cancer cases using High Resolution Melting. Results Our analysis indicated that the rs2910164 polymorphism is associated with breast cancer risk in both primary and replicate populations (p = 0.03 and 0.0013, respectively). In contrast to the results of familial breast cancer studies, however, we found that the presence of the G allele of rs2910164 is associated with increased cancer risk, with an OR of 1.77 (95% CI 1.40–2.23). Conclusions The microRNA miR146a has a potential role in the development of breast cancer and the effects of its SNPs require further inquiry to determine the nature of their influence on breast tissue and cancer.
Resumo:
Asymmetric diadenosine tetraphosphate (Ap(4)A) hydrolases degrade the metabolite Ap(4)A back into ATP and AMP. The three-dimensional crystal structure of Ap(4)A hydrolase (16 kDa) from Aquifex aeolicus has been determined in free and ATP-bound forms at 1.8 and 1.95 angstrom resolution, respectively. The overall three-dimensional crystal structure of the enzyme shows an alpha beta alpha-sandwich architecture with a characteristic loop adjacent to the catalytic site of the protein molecule. The ATP molecule is bound in the primary active site and the adenine moiety of the nucleotide binds in a ring-stacking arrangement equivalent to that observed in the X-ray structure of Ap(4)A hydrolase from Caenorhabditis elegans. Binding of ATP in the active site induces local conformational changes which may have important implications in the mechanism of substrate recognition in this class of enzymes. Furthermore, two invariant water molecules have been identified and their possible structural and/or functional roles are discussed. In addition, modelling of the substrate molecule at the primary active site of the enzyme suggests a possible path for entry and/or exit of the substrate and/or product molecule.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.