975 resultados para Th1-type immune response


Relevância:

100.00% 100.00%

Publicador:

Resumo:

There is increasing interest in the immune response induced by plant viruses since these could be used as antigen-expressing systems in vaccination procedures. Cowpea severe mosaic virus (CPSMV), as a purified preparation (300 g of leaves, 2 weeks post-inoculation), or crude extract from cowpea (Vigna unguiculata) leaves infected with CPSMV both administered by gavage to Swiss mice induced a humoral immune response. Groups of 10 Swiss mice (2-month-old females) were immunized orally with 10 daily doses of either 50 µg viral capsid protein (boosters of 50 µg at days 21 and 35 after immunization) or 0.6 mg protein of the crude extract (boosters of 0.6 mg at days 21 and 35 after immunization). Anti-CPSMV antibodies were quantified by ELISA in pooled sera diluted at least 1:400 at days 7, 14, 21, 28, 35 and 42 after the 10th dose. IgG and IgA against CPSMV were produced systemically, but IgE was not detected. No synthesis of specific antibodies against the proteins of leaf extracts from V. unguiculata, infected or not with CPSMV, was detected. The use of CPSMV, a plant-infecting virus that apparently does not induce a pathogenic response in animals, induced a humoral and persistent (at least 6 months) immune response through the administration of low antigen doses by gavage. These results raise the possibility of using CPSMV either as a vector for the production of vaccines against animal pathogens or in quick and easy methods to produce specific antisera for viral diagnosis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We have evaluated the cellular and humoral immune response to primary respiratory syncytial virus (RSV) infection in young infants. Serum specimens from 65 patients <=12 months of age (39 males and 26 females, 28 cases <3 months and 37 cases > or = 3 months; median 3 ± 3.9 months) were tested for anti-RSV IgG and IgG subclass antibodies by EIA. Flow cytometry was used to characterize cell surface markers expressed on peripheral blood mononuclear cells (PBMC) from 29 RSV-infected children. There was a low rate of seroconversion in children <3 months of age, whose acute-phase PBMC were mostly T lymphocytes (63.0 ± 9.0%). In contrast, a higher rate of seroconversion was observed in children >3 months of age, with predominance of B lymphocytes (71.0 ± 17.7%). Stimulation of PBMC with RSV (2 x 10(5) TCID50) for 48 h did not induce a detectable increase in intracellular cytokines and only a few showed a detectable increase in RSV-specific secreted cytokines. These data suggest that age is an important factor affecting the infants' ability to develop an immune response to RSV.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Allergy is characterized by T helper (Th) 2-type immune response after encounter with an allergen leading to subsequent immunoglobulin (Ig) E-mediated hypersensitivity reaction and further allergic inflammation. Allergen-specific immunotherapy (SIT) balances the Th2-biased immunity towards Th1 and T regulatory responses. Adjuvants are used in allergen preparations to intensify and modify SIT. β-(1,2)-oligomannoside constituents present in Candida albicans (C. albicans) cell wall possess Th1-type immunostimulatory properties. The aim of this thesis was to develop a β-(1,2)-linked carbohydrate compound with known structure and anti-allergic properties to be applied as an adjuvant in SIT. First the immunostimulatory properties of various fungal extracts were studied. C. albicans appeared to be the most promising Th1-inducing extract, which led to the synthesis of various mono- or divalent oligomannosides designed on the basis of C. albicans. These carbohydrates did not induce strong cytokine production in human peripheral blood mononuclear cell (PBMC) cultures. In contrast to earlier reports using native oligosaccharides from C. albicans, synthetic -(1,2)-linked mannotetraose did not induce any tumor necrosis factor production in murine macrophages. Next, similarities with synthesized divalent mannosides and the antigenic epitopes of β-(1,2)-linked C. albicans mannan were investigated. Two divalent compounds inhibited specific IgG antibodies binding to below 3 kDa hydrolyzed mannan down to the level of 30–50% showing similar antigenicity to C. albicans. Immunomodulatory properties of synthesized carbohydrate assemblies ranging from mono- to pentavalent were evaluated. A trivalent acetylated dimannose (TADM) induced interleukin-10 (IL-10) and interferon-γ responses. TADM also suppressed birch pollen induced IL-4 and IL-5 responses in allergen (Bet v) stimulated PBMCs of birch pollen allergic subjects. This suppression was stronger with TADM than with other used adjuvants, immunostimulatory oligonucleotides and monophosphoryl lipid A. In a murine model of asthma, the allergen induced inflammatory responses could also be suppressed by TADM on cytokine and antibody levels.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Patients with gastric cancer have a variety of immunological abnormalities. In the present study the lymphocytes and their subsets were determined in the peripheral blood of patients with gastric cancer (N = 41) both before and after surgical treatment. The percent of helper/inducer CD4 T cells (43.6 ± 8.9) was not different after tumor resection (43.6 ± 8.2). The percent of the cytotoxic CD8+ T cell population decreased significantly, whether patients were treated surgically (27.2 ± 5.8%, N = 20) or not (27.3 ± 7.3%, N = 20) compared to individuals with inflammatory disease (30.9 ± 7.5%) or to healthy individuals (33.2 ± 7.6%). The CD4/CD8 ratio consequently increased in the group of cancer patients. The peripheral blood lymphocytes of gastric cancer patients showed reduced responsiveness to mitogens. The defective blastogenic response of the lymphocytes was not associated with the production of transforming growth factor beta (TGF-ß) since the patients with cancer had reduced production of TGF-ß1 (269 ± 239 pg/ml, N = 20) in comparison to the normal individuals (884 ± 175 pg/ml, N = 20). These results indicate that the immune response of gastric cancer patients was not significantly modified by surgical treatment when evaluated four weeks after surgery and that the immunosuppression observed was not due to an increase in TGF-ß1 production by peripheral leukocytes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Human cytomegalovirus (CMV) infection is common in most people but nearly asymptomatic in immunocompetent individuals. After primary infection the virus persists throughout life in a latent form in a variety of tissues, particularly in precursor cells of the monocytic lineage. CMV reinfection and occurrence of disease are associated with immunosuppressive conditions. Solid organ and bone marrow transplant patients are at high risk for CMV disease as they undergo immunosuppression. Antiviral treatment is effective in controlling viremia, but 10-15% of infected patients can experience CMV disease by the time the drug is withdrawn. In addition, long-term antiviral treatment leads to bone marrow ablation and renal toxicity. Furthermore, control of chronic CMV infection in transplant recipients appears to be dependent on the proper recovery of cellular immunity. Recent advances in the characterization of T-cell functions and identification of distinct functional signatures of T-cell viral responses have opened new perspectives for monitoring transplant individuals at risk of developing CMV disease.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Two recombinant baculoviruses were produced in order to obtain a bovine viral diarrhea virus (BVDV) immunogen: AcNPV/E2 expressing E2 glycoprotein, and AcNPV/E0E1E2 expressing the polyprotein region coding for the three structural proteins of BVDV (E0, E1, and E2). Mice were immunized with Sf9 cells infected with the recombinant baculoviruses in a water in oil formulation and the production of neutralizing antibodies was evaluated. Since E2 elicited higher neutralizing antibody titers than E0-E1-E2 polyprotein, it was selected to immunize cattle. Calves received two doses of recombinant E2 vaccine and were challenged with homologous BVDV 37 days later. The recombinant immunogen induced neutralizing titers which showed a mean value of 1.5 ± 0.27 on the day of challenge and reached a top value of 3.36 ± 0.36, 47 days later (84 days post-vaccination). On the other hand, sera from animals which received mock-infected Sf9 cells did not show neutralizing activity until 25 days post-challenge (62 days post-vaccination), suggesting that these antibodies were produced as a consequence of BVDV challenge. Even when no total protection was observed in cattle, in vitro viral neutralization assays revealed that the recombinant immunogen was able to induce neutralizing antibody synthesis against the homologous strain as well as against heterologous strains in a very efficient way.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

National Centre for Aquatic Animal Health, Cochin University of Science and Technology

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Eight hundred and eighty-¢ve strains of bacterial isolates fromvarious samples associatedwith the natural habitat ofMacrobrachiumrosenbergii were screened for their probiotic potential. Two putative probionts namely Bacillus NL110 and Vibrio NE17 isolated from the larvae and egg samples, respectively, were selected for experimental studies and were introduced to the juveniles of M. rosenbergii (0.080 0.001g) through di¡erent modes such as through feed, water and both. The probiotic potential of the above bacteria in terms of improvements inwater quality, growth, survival, speci¢c growth rate (SGR), feed conversion ratio and immune parameters was evaluated. The treatment groups showed a signi¢cant improvement in SGR and weight gain (Po0.001). Survival among di¡erent treatment groups was better than that in the control group. There were also signi¢cant improvements in the water quality parameters such as the concentration of nitrate and ammonia in the treatment groups (Po0.05). Improvements in immune parameters such as the total haemocyte count (Po0.05), phenoloxidase activity and respiratory burst were also signi¢cant (Po0.001). It is concluded that screening of the natural micro£ora of cultured ¢sh and shell¢sh for putative probionts might yield probiotic strains of bacteria that could be utilized for an environment-friendly and organic mode of aquaculture.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Eight hundred and eighty-¢ve strains of bacterial isolates fromvarious samples associatedwith the natural habitat ofMacrobrachiumrosenbergii were screened for their probiotic potential. Two putative probionts namely Bacillus NL110 and Vibrio NE17 isolated from the larvae and egg samples, respectively, were selected for experimental studies and were introduced to the juveniles of M. rosenbergii (0.080 0.001g) through di¡erent modes such as through feed, water and both. The probiotic potential of the above bacteria in terms of improvements inwater quality, growth, survival, speci¢c growth rate (SGR), feed conversion ratio and immune parameters was evaluated. The treatment groups showed a signi¢cant improvement in SGR and weight gain (Po0.001). Survival among di¡erent treatment groups was better than that in the control group. There were also signi¢cant improvements in the water quality parameters such as the concentration of nitrate and ammonia in the treatment groups (Po0.05). Improvements in immune parameters such as the total haemocyte count (Po0.05), phenoloxidase activity and respiratory burst were also signi¢cant (Po0.001). It is concluded that screening of the natural micro£ora of cultured ¢sh and shell¢sh for putative probionts might yield probiotic strains of bacteria that could be utilized for an environment-friendly and organic mode of aquaculture

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The thesis deals with the prevalence and distribution of motile aeromonads in selected ornamental fishes. The presence of motile aeromonads in ornamental fishes and associated carriage water is well documented. Though aeromonads are a part of autochthonous flora of natural waters, disease outbreak occurs as a result of environmental stress on the cultured species and virulence of the pathogens. While ornamental aquaculture in many parts of the world is highly organized and practiced scientifically, it is highly unorganized in India. The culture ponds/tanks are often maintained in very poor manner and the fishes are subjected to high degree of stress during transportation from the production facility to retail vendors. The situation is no better at retail outlets, where fishes are maintained in crowded condition without proper aeration or food. All these could result in high prevalence of diseases caused by motile aeromonads. No systematic study has been carried out to understand the prevalence of motile aeromonads in ornamental fishes and carriage water . It also gives an account of the production of extracellular virulence factors and the antibiogram of the different species of motile aeromonads isolated. The growth characteristics and virulence potential of a representative strain of Aeromonas hydrophila is also studied. The nucleotide sequencing of the strain was carried out and sequences deposited in Genbank. Survival and immune response of Cyprinus carpio under different stress conditions and on probiotic treatment with Bacillus NL110, when challenged with A. hydrophila is also dealt within this thesis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study aimed at evaluating the effects of different levels of rosemary (Rosmarinus officinalis) extract on growth rate, hematology and cell-mediated immune response in Markhoz newborn goat kids. Twenty four goat kids (aged 7 +/- 3 days) were randomly allotted to four groups with six replicates. The groups included: control, T1, T2 and T3 groups which received supplemented-milk with 0, 100, 200 and 400mg aqueous rosemary extract per kg of live body weight per day for 42 days. Body weights of kids were measured weekly until the end of the experiment. On day 42, 10 ml blood samples were collected from each kid through the jugular vein. Cell-mediated immune response was assessed through the double skin thickness after intradermal injection of phyto-hematoglutinin (PHA) at day 21 and 42. No significant differences were seen in initial body weight, average daily gain (ADG) and total gain. However, significant differences in globulin (P <0.05), and white blood cells (WBC) (P <0.001) were observed. There were no significant differences in haemoglobin (Hb), packed cell volume (PCV), red blood cells (RBC), lymphocytes and neutrophils between the treatments. Skin thickness in response to intra dermal injection of PHA significantly increased in the treated groups as compared to the control group at day 42 (P< 0.01) with the T3 group showing the highest response to PHA injection. In conclusion, the results indicated that aqueous rosemary extract supplemented-milk had a positive effect on immunity and skin thickness of newborn goat kids.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The outer domain (OD) of human immunodeficiency virus (HIV)-1 gp120 represents an attractive, if difficult, target for a beneficial immune response to HIV infection. Unlike the entire gp120, the OD is structurally stable and contains the surfaces that interact with both the primary and secondary cellular receptors. The primary strain-specific neutralizing target, the V3 loop, lies within the OD, as do epitopes for two cross-reactive neutralizing monoclonal antibodies (mAbs), b12 and 2G12, and the contact sites for a number of inhibitory lectins. The OD is poorly immunogenic, at least in the context of complete gp120, but purposeful OD immunization can lead to a substantial antibody response. Here, we map the antibody generated following immunization with a clade C OD. In contrast to published data for the clade B OD, the majority of the polyclonal response to the complete clade C OD is to the V3 loop; deletion of the loop substantially reduces immunogenicity. When the loop sequence was substituted for the epitope for 2F5, a well-characterized human cross-neutralizing mAb, a polyclonal response to the epitope was generated. A panel of mAbs against the clade C OD identified two mAbs that reacted with the loop and were neutralizing for clade C but not B isolates. Other mAbs recognized both linear and conformational epitopes in the OD. We conclude that, as for complete gp120, V3 immunodominance is a property of OD immunogens, that the responses can be neutralizing and that it could be exploited for the presentation of other epitopes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The effect of highly active antiretroviral therapy (HAART) on HCV replication is controversial, with some studies reporting no effect and others increases, reductions and even clearances of HCV RNA after treatment. In this study, the effect of HAART was investigated on the titre of anti-HCV specific antibodies and on the relationship between these antibodies and HCV RNA level in a cohort of 24 patients with inherited bleeding disorders. A significant inverse correlation between antibodies to both total HCV proteins and HCV RNA (R = -0.42, P = 0.05) and between antibodies to HCV envelope glycoproteins and HCV RNA (R = -0.54, P = 0.01) was observed pre-HAART. The relationship disappeared or was obscured after therapy (R = 0.24, P = 0.30 and R = 0.16, P = 0.50, respectively). Thus, we show that HAART affects the HCV specific humoral immune responses without affecting the HCV RNA level. (C) 2004 Wiley-Liss, Inc.