877 resultados para RICH DIET


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Las Campanas Observatory and Anglo-Australian Telescope Rich Cluster Survey (LARCS) is a panoramic imaging and spectroscopic survey of an X-ray luminosity-selected sample of 21 clusters of galaxies at 0.07 < z < 0.16. Charge-coupled device (CCD) imaging was obtained in B and R of typically 2 degrees wide regions centred on the 21 clusters, and the galaxy sample selected from the imaging is being used for an on-going spectroscopic survey of the clusters with the 2dF spectrograph on the Anglo-Australian Telescope. This paper presents the reduction of the imaging data and the photometric analysis used in the survey. Based on an overlapping area of 12.3 deg(2) we compare the CCD-based LARCS catalogue with the photographic-based galaxy catalogue used for the input to the 2dF Galaxy Redshift Survey (2dFGRS) from the APM, to the completeness of the GRS/APM catalogue, b(J) = 19.45. This comparison confirms the reliability of the photometry across our mosaics and between the clusters in our survey. This comparison also provides useful information concerning the properties of the GRS/APM. The stellar contamination in the GRS/APM galaxy catalogue is confirmed as around 5-10 per cent, as originally estimated. However, using the superior sensitivity and spatial resolution in the LARCS survey evidence is found for four distinct populations of galaxies that are systematically omitted from the GRS/APM catalogue. The characteristics of the 'missing' galaxy populations are described, reasons for their absence examined and the impact they will have on the conclusions drawn from the 2dF Galaxy Redshift Survey are discussed.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present a photometric investigation of the variation in galaxy colour with environment in 11 X-ray-luminous clusters at 0.07 less than or equal to z less than or equal to 0.16 taken from the Las Campanas/AAT Rich Cluster Survey. We study the properties of the galaxy populations in individual clusters, and take advantage of the homogeneity of the sample to combine the clusters together to investigate weaker trends in the composite sample. We find that modal colours of galaxies lying on the colour-magnitude relation in the clusters become bluer by d(B - R)/dr(p) = -0.022 +/- 0.004 from the cluster core out to a projected radius of r(p) = 6 Mpc, further out in radius than any previous study. We also examine the variation in modal galaxy colour with local galaxy density, 2, for galaxies lying close to the colour-magnitude relation, and find that the median colour shifts bluewards by d(B - R)/d log(10)(Sigma) = -0.076 +/- 0.009 with decreasing local density across three orders of magnitude. We show that the position of the red envelope of galaxies in the colour-magnitude relation does not vary as a function of projected radius or density within the clusters, suggesting that the change in the modal colour results from an increasing fraction of bluer galaxies within the colour-magnitude relation, rather than a change in the colours of the whole population. We show that this shift in the colour-magnitude relations with projected radius and local density is greater than that expected from the changing morphological mix based on the local morphology-density relation. We therefore conclude that we are seeing a real change in the properties of galaxies on the colour-magnitude relation in the outskirts of clusters. The simplest interpretation of this result (and similar constraints in local clusters) is that an increasing fraction of galaxies in the lower density regions at large radii within clusters exhibit signatures of star formation in the recent past, signatures which are not seen in the evolved galaxies in the highest density regions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article addresses the interactions of the synthetic antimicrobial peptide dermaseptin 01 (GLWSTIKQKGKEAAIAAA-KAAGQAALGAL-NH(2), DS 01) with phospholipid (PL) monolayers comprising (i) a lipid-rich extract of Leishmania amazonensis (LRE-La), (ii) zwitterionic PL (dipalmitoylphosphatidylcholine, DPPC), and (iii) negatively charged PL (dipalmitoylphosphatidylglycerol, DPPG). The degree of interaction of DS 01 with the different biomembrane models was quantified from equilibrium and dynamic liquid-air interface parameters. At low peptide concentrations, interactions between DS 01 and zwitterionic PL, as well as with the LRE-La monolayers were very weak, whereas with negatively charged PLs the interactions were stronger. For peptide concentrations above 1 mu g/ml, a considerable expansion of negatively charged monolayers occurred. In the case of DPPC, it was possible to return to the original lipid area in the condensed phase, suggesting that the peptide was expelled from the monolayer. However, in the case of DPPG, the average area per lipid molecule in the presence of DS 01 was higher than pure PLs even at high surface pressures, suggesting that at least part of DS 01 remained incorporated in the monolayer. For the LRE-La monolayers, DS 01 also remained in the monolayer. This is the first report on the antiparasitic activity of AMPs using Langmuir monolayers of a natural lipid extract from L. amazonensis. Copyright (C) 2011 European Peptide Society and John Wiley & Sons, Ltd.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to determine the occurrence of symptoms of binge eating (BE) among children and adolescents seeking treatment for their obesity, as well as to evaluate their diet composition and metabolic characteristics. The Binge Eating scale (BES) was answered by 128 children and adolescents (10.77 +/- 2.04 years, BMI 29.15 +/- 4.98 kg/m(2), BMI Z score 2.28 +/- 0.46, 53.91% pubescent), who were classified into two subgroups-binge eaters (score greater than or equal to IS points) and non-binge eaters (score lower than 18 points). Anthropometric data, body composition and Tanner stages were collected and dietary evaluation conducted. Blood pressure was determined, and glucose, lipid profile and insulin assays were performed. insulin resistance was determined using HOMA-IR. BE symptoms were present in 39.06% of patients. Carbohydrate intake in diet composition was significantly higher among binge eaters. Children with BE did not demonstrate significant dissimilar metabolic characteristics when compared to their counterparts without BE. Therefore, BE seems to be a prevalent problem among children and adolescents seeking help for their obesity. When associated with obesity, this eating behaviour can influence macronutrient consumption through increased carbohydrate intake. Further research would be valuable to verify the reproducibility of these findings. (c) 2007 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To describe the case of a patient with celiac disease who achieved a complete response to a gluten-free diet. A 28-year-old woman presented with diarrhea, oral ulcers, and refractory uveitis of 2.5-years duration. She was treated with prednisone, mydriatic drops, and infliximab with no response. She was referred to our hospital at which point her previous diagnosis of uveitis was confirmed; she was also diagnosed with right-sided sacro-iliitis. The patient did not have arthritis or any skin conditions. Three tests for fecal parasites and a fecal leukocyte were negative. Endoscopy revealed atrophic appearance of the duodenal mucosa. Biopsy showed atrophy of the duodenal villi with intra-epithelial lymphocytes, hyperplasia of the crypts, and chronic inflammatory infiltrate. The search for antiendomysial antibody was > 1/1,280. The patient was started on a gluten-free diet and after 3 months demonstrated significant improvement of gastrointestinal symptoms and uveitis, as well as a reduction of antiendomysial antibodies (1/80). After 6 months, there was complete remission of gastrointestinal symptoms and total control of uveitis. The antiendomysial antibody was negative at that time. Clinical uveitis as a manifestation of celiac disease has been described in only two cases in the literature. This case study is the third to demonstrate that uveitis is a clinical symptom that can be addressed in patients with celiac disease.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Search path, searching behaviour and diet of pairs of Oystercatchers feeding in mudflat territories were studied during spring. females ate Nereis, Mya, small unidentified prey, probably Corophium, and a few Macoma, whereas males primarily ate Macoma. Even when female and male foraged in the same site, they often caught different prey. The combination of 'The Search-rate/Detection Model' (Gendron & Staddon 1983) and 'The Harvestable Prey Model' (Zwarts & Wanink 1993) provide the theoretical framework in which to explain these differences in diet. Macoma are thought to be more cryptic than Nereis, Mya and Corophium. Therefore females, while searching at a faster rate than their respective mates, caught far fewer cryptic prey, but a greater number of more conspicuous prey than their mates. On the basis of distances moved before and after capturing prey, males exhibited area-restricted searching for Macoma and Corophium. In contrast, females did not exhibit any area-restricted searching. it is suggested that the distribution of Macoma and Corophium available to males searching slowly was more clumped than that of these two prey species available to females searching more quickly.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Dietary salt restriction has been reported to adversely modify the plasma lipoprotein profile in hypertensive and in normotensive subjects. We investigated the effects of the low sodium intake (LSI) on the plasma lipoprotein profile and on inflammation and thrombosis biomarkers during the fasting and postprandial periods. Methods: Non-obese, non-treated hypertensive adults (n=41) were fed strictly controlled diets. An initial week on a control diet (CID, Na=160 mmol/day) was followed by 3 weeks on LSI (Na=60mmol/day). At admission and on the last day of each period, the 24-h ambulatory blood pressure was monitored and blood was drawn after an overnight fasting period and after a fat-rich test meal. Results: The dietary adherence was confirmed by 24-h urinary sodium excretion. Fasting triglyceride (TG), chylomicron-cholesterol, hsC-reactive protein (CRP), tumor necrosis factor-a (TNF-alpha). interleukin-6 (IL-6) concentrations, renin activity, aldosterone, insulin, and homeostasis model assessment insulin resistance (HOMA-IR) Values were higher, but non-esterified fatty acids (NEFA) were lower on LSI than on CD. For LSI, areas under the curve (AUC) of TG, chylomicron-cholesterol, apoB and the cholesterol/apoB ratio were increased, whereas AUC-NEFA was lowered. LSI did not modify body weight, hematocrit, fasting plasma cholesterol, glucose, adiponectin, leptin, fibrinogen and factor VII (FVII), and AUC of lipoprotein lipase and of lipoprotein remnants. Conclusion: LSI induced alterations in the plasma lipoproteins and in inflammatory markers that are common features of the metabolic syndrome. (C) 2008 Elsevier Ireland Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Lipid emulsions that mimic natural lipoproteins help to understand the metabolism and the constitutional organization of circulating lipids. Chylomicrons synthesised by enterocyte cells usually contain oxysterols such as 7-ketocholesterol (7-KC). Here we describe the development of a 7-KC-containing emulsion as a model for oxisterol-rich chylomicron. Different amounts of 7-KC were used. Emulsion characteristics as effective diameter, lipid saturation with radiolabeled lipids was evaluated. In conclusion, the production of a synthetic 7-KC-rich emulsion resembling hylomicrons was feasible, being a model for in vivo metabolism studies.