Dinuclear copper and zinc complexes of a hexaazamacrocycle containing p-xylyl spacers and bridging anions: theoretical and spectroscopic studies

The hexaazamacrocycle 7,22-dimethyl-3,7,11,18,22,26-hexaazatricyclo[26.2.2.2(13,16)] tetratriaconta-1(30), 13,15,28,31,33- hexaene (Me-2[30] pbz(2)N(6)) was synthesized and characterised by single crystal X-ray diffraction. The macrocycle adopts a conformation with the two aromatic rings almost parallel at a distance of ca. 4.24 Angstrom, but displaced relative to each other by ca. 1.51 Angstrom. The protonation constants of this compound and the stability constants of its complexes with Cu2+ and Zn2+, were determined in water - methanol (9 : 1 v/v) at 25 degreesC with ionic strength 0.10 mol dm(-3) in KCl. The potentiometric and spectroscopic studies (NMR of zinc, cadmium and lead complexes, and EPR of the copper complexes) indicate the formation of only dinuclear complexes. The association constants of the dinuclear copper complex with anions ( thiocyanate, terephthalate and glyphosate) and neutral molecules (1,4-benzenedimethanol, p-xylylenediamine and terephthalic acid) were determined at 20 degreesC in methanol. The structural preferences of this ligand and of its dinuclear copper(II) complex with a variety of bridging ligands were evaluated theoretically by molecular mechanics calculations (MM) and molecular dynamics (MD) using quenching techniques.

Binding studies of a protonated dioxatetraazamacrocycle with carboxylate substrates

The tetraprotonated form of the dioxatetraazamacrocycle, 6,19-dioxa-3,9,16,22-tetraaza[22.2.2.2(11,14)]-triaconta-1(26),11,13,24, 27,29-hexaene, (H4L1)(4+), was used as the receptor for binding studies with carboxylate anionic substrates of different shapes, sizes, and charges [succinate (suc(2-)), cyclo- hexanetricarboxylate (cta(3-)), phthalate (ph(2-)), isophthalate (iph(2-)), terephthalate (tph(2-)), and benezenetricarboxylate (btc(3-))]. Association constants were determined by potentiometry in aqueous solution at 298.2 K and 0.10 M KCl and by H-1 NMR titration in D2O. The strongest association was found for the btc3- anion at 5-7 pH region. From both techniques it was possible to establish the binding preference trend of the receptor for the different substrates, and the H-1 NMR spectroscopy gave important suggestions about the type of interactions between partners and the location of the substrates in the supramolecular entities formed. The effective binding constants at pH 6 follow the order: btc(3-)>iph(2-)>cta(3-) =ph(2-)>tph(2-)>suc(2-). All the studies suggest that the anionic substrates bind to the receptor via N-H center dot center dot center dot O = C hydrogen bonds and electrostatic interactions, and the aromatic substrates can also establish pi-pi stacking interactions. The crystal structures of (H4L1)(4+) and its supramolecular assemblies with ph(2-) and tph(2-) were determined by X-ray diffraction. The last two structures showed that the association process in solid state occurs via multiple N-H center dot center dot center dot O = C hydrogen bonds with the anionic substrate located outside the macrocyclic cavity of the receptor. Molecular dynamics simulations carried out for the association of (H4L1)(4+) with tph(2-) and btC(3-) in water solution established at atomic level the existence of all interactions suggested by the experimental studies, which act cooperatively in the binding process. Furthermore, the binding free energies were estimated and the values are in agreement with the experimental ones, indicating that the binding of these two anionic substrates occurs into the receptor cavity. However, the tph(2-) has also propensity to leave the macrocyclic cavity and its molecular recognition can also happen at the top of the receptor. (C) 2008 Elsevier Ltd. All rights reserved.

Bending, twisting, and breaking CuCN chains to produce framework materials: the reactions of CuCN with alkali-metal halides

The reactions of the low-temperature polymorph of copper(I) cyanide (LT-CuCN) with concentrated aqueous alkali-metal halide solutions have been investigated. At room temperature, KX (X = Br and I) and CsX (X = Cl, Br, and I) produce the addition products K[Cu-2(CN)(2)Br](H2O)-H-. (I), K-3[Cu-6(CN)(6)I-3](.)2H(2)O (II), Cs[Cu-3(CN)(3)Cl] (III), Cs[Cu-3(CN)(3)Br] (IV), and Cs-2[Cu-4(CN)(4)I-2](H2O)-H-. (V), with 3-D frameworks in which the -(CuCN)- chains present in CuCN persist. No reaction occurs, however, with NaX (X = Cl, Br, I) or KCl. The addition compounds, I-V, reconvert to CuCN when washed. Both low- and high-temperature polymorphs of CuCN (LT- and HT-CuCN) are produced, except in the case of Cs[Cu-3(CN)(3)Cl] (III), which converts only to LT-CuCN. Heating similar AX-CuCN reaction mixtures under hydrothermal conditions at 453 K for 1 day produces single crystals of I-V suitable for structure determination. Under these more forcing conditions, reactions also occur with NaX (X = Cl, Br, I) and KCl. NaBr and KCl cause some conversion of LT-CuCN into HT-CuCN, while NaCl and NaI, respectively, react to form the mixed-valence Cu(I)/Cu(II) compounds [Cu-II(OH2)(4)][Cu-4(I)(CN)(6)], a known phase, and [Cu-II(OH2)(4)][Cu-4(I)(CN)(4)I-2] (VI), a 3-D framework, which contains infinite -(CuCN)- chains. After 3 days of heating under hydrothermal conditions, the reaction between KI and CuCN produces [Cu-II(OH2)(4)][Cu-2(I)(CN)I-2](2) (VII), in which the CuCN chains are broken into single Cu-CN-Cu units, which in turn are linked into chains via iodine atoms and then into layers via long Cu-C and Cu-Cu interactions.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Preparation and magnetic properties of La–Mn and La–Co doped barium hexaferrites prepared via an improved co-precipitation/molten salt method

LaMn and LaCo doped barium hexaferrites of formula Ba(1-x)LaxFe(12-x)MxO19 (M=Mn, Co) (x=0.05 to 0.40) were prepared with an improved co-precipitation/molten salt method. For the synthesis, aqueous solutions of the appropriate metal chlorides were prepared in the ratio required except that the initial mole ratio of Fe and dopants to Ba was chosen to be 11:1, and then mixed with excess Na2CO3. The solutions were then cooled, filtered off, dried, then mixed with KCl flux, and heated at 450 degrees C and for 2 h. The temperature was then raised to 950 degrees C and kept for 4 h, then cooled. This new synthesis method, which employs a lower temperature and shorter reaction time, gives products with improved crystallinity and purity while the saturation magnetization and coercivity values are comparable with those synthesized via the high temperature method.

The Henslowe-Allyen Digitisation Project

2000 digital photographs of manuscript pages in the single most inportant theatrical archive in the age of Shakespeare, as well as 15 digital essays by world-leading scholars

Salts responsive nanovesicles through π-stacking induced self-assembly of backbone modified tripeptides

A set of backbone modified peptides of general formula Boc-Xx-m-ABA-Yy-OMe where m-ABA is meta-aminobenzoic acid and Xx and Yy are natural amino acids such as Phe, Gly, Pro, Leu, Ile, Tyr and Trp etc., are found to self-assemble into soft nanovesicular structures in methanol-water solution (9:1 by v/v). At higher concentration the peptides generate larger vesicles which are formed through fusion of smaller vesicles. The formation of vesicles has been facilitated through the participation of various noncovalent interactions such as aromatic pi-stacking, hydrogen bonding and hydrophobic interactions. Model study indicates that the pi-stacking induced self-assembly, mediated by m-ABA is essential for well structured vesicles formation. The presence of conformationally rigid m-ABA in the backbone of the peptides also helps to form vesicular structures by restricting the conformational entropy. The vesicular structures get disrupted in presence of various salts such as KCl, CaCl(2), N(n-Bu)(4)Br and (NH(4))(2)SO(4) in methanol-water solution. Fluorescence microscopy and UV studies reveal that the soft nanovesicles encapsulate organic dye molecules such as Rhodamine B and Acridine Orange which could be released through salts induced disruption of vesicles.

Neurogenic responses mediated by vanilloid receptor-1 (TRPV1) are blocked by the high affinity antagonist, iodo-resiniferatoxin

(1) Stimulation of the vanilloid receptor-1 (TRPV1) results in the activation of nociceptive and neurogenic inflammatory responses. Poor specificity and potency of TRPV1 antagonists has, however, limited the clarification of the physiological role of TRPV1. (2) Recently, iodo-resiniferatoxin (I-RTX) has been reported to bind as a high affinity antagonist at the native and heterologously expressed rat TRPV1. Here we have studied the ability of I-RTX to block a series of TRPV1 mediated nociceptive and neurogenic inflammatory responses in different species (including transfected human TRPV1). (3) We have demonstrated that I-RTX inhibited capsaicin-induced mobilization of intracellular Ca(2+) in rat trigeminal neurons (IC(50) 0.87 nM) and in HEK293 cells transfected with the human TRPV1 (IC(50) 0.071 nM). (4) Furthermore, I-RTX significantly inhibited both capsaicin-induced CGRP release from slices of rat dorsal spinal cord (IC(50) 0.27 nM) and contraction of isolated guinea-pig and rat urinary bladder (pK(B) of 10.68 and 9.63, respectively), whilst I-RTX failed to alter the response to high KCl or SP. (5) Finally, in vivo I-RTX significantly inhibited acetic acid-induced writhing in mice (ED(50) 0.42 micro mol kg(-1)) and plasma extravasation in mouse urinary bladder (ED(50) 0.41 micro mol kg(-1)). (6) In in vitro and in vivo TRPV1 activated responses I-RTX was approximately 3 log units and approximately 20 times more potent than capsazepine, respectively. This high affinity antagonist, I-RTX, may be an important tool for future studies in pain and neurogenic inflammatory models.

Fenofibrate and Pioglitazone Do Not Ameliorate the Altered Vascular Reactivity in Aorta of Isoproterenol-treated Rats

Chronic stimulation of beta-adrenoceptors with isoproterenol induces alteration of vascular reactivity and increases local proinflammatory cytokines. We investigated whether fenofibrate and pioglitazone, PPAR-alpha and -gamma agonists, respectively, improve the changes in vascular reactivity induced by isoproterenol. Wistar rats received isoproterenol (0.3 mg.kg(-1).day(-1), SC) or vehicle (CT) plus fenofibrate (alpha, 100 mg.kg(-1).day(-1), PO), pioglitazone (gamma, 2.5 mg.kg(-1).day(-1), PO), or water for 7 days. In aortas, isoproterenol treatment enhanced the maximal response (Rmax) to phenylephrine (10(-10) to 10(-4) M) compared to CT as previously demonstrated. The effects of endothelium removal (E-) or L-NAME incubation (100 mu M) on the phenylephrine response were smaller in isoproterenol-treated animals compared to CT while superoxide dismutase (SOD, 150 U/mL) significantly reduced the Rmax to phenylephrine to CT levels. Neither fenofibrate nor pioglitazone changed the effects induced by isoproterenol in aorta. E-, L-NAME, or SOD effects were similar between CT alpha and CT. However, pioglitazone per se increased Rmax to phenylephrine (CT: 59 +/- 4 versus CT gamma: 72 +/- 5 % of contraction to KCl). E- or L-NAME effects were reduced in CT gamma compared to CT, and SOD normalized the altered reactivity to phenylephrine in the CT gamma group. In conclusion, neither fenofibrate nor pioglitazone ameliorates the altered vascular reactivity present in aorta from isoproterenol-treated rats. Moreover, pioglitazone per se induced endothelial dysfunction and increased phenylephrine-induced contraction in aorta.

Time-dependent increases in ouabain-sensitive Na(+), K(+)-ATPase activity in aortas from diabetic rats: The role of prostanoids and protein kinase C

Aims: Na(+), K(+)-ATPase activity contributes to the regulation of vascular contractility and it has been suggested that vascular Na(+), K(+)-ATPase activity may be altered during the progression of diabetes; however the mechanisms involved in the altered Na(+), K(+)-ATPase activity changes remain unclear. Thus, the aim of the present study was to evaluate ouabain-sensitive Na(+), K(+)-ATPase activity and the mechanism(s) responsible for any alterations on this activity in aortas from 1- and 4-week streptozotocin-pretreated (50 mg kg(-1), i.v.) rats. Main methods: Aortic rings were used to evaluate the relaxation induced by KCl (1-10 mM) in the presence and absence of ouabain (0.1 mmol/L) as an index of ouabain-sensitive Na(+), K(+)-ATPase activity. Protein expression of COX-2 and p-PKC-beta II in aortas were also investigated. Key findings: Ouabain-sensitive Na(+), K(+)-ATPase activity was unaltered following 1-week of streptozotocin administration, but was increased in the 4-week diabetic aorta (27%). Endothelium removal or nitric oxide synthase inhibition with L-NAME decreased ouabain-sensitive Na(+), K(+)-ATPase activity only in control aortas. In denuded aortic rings, indomethacin. NS-398, ridogrel or Go-6976 normalized ouabain-sensitive Na(+), K(+)-ATPase activity in 4-week diabetic rats. In addition, COX-2 (51%) and p-PKC-beta II (59%) protein expression were increased in 4-week diabetic aortas compared to controls. Significance: In conclusion, diabetes led to a time-dependent increase in ouabain-sensitive Na(+), K(+)-ATPase activity. The main mechanism involved in this activation is the release of TxA(2)/PGH(2) by COX-2 in smooth muscle cells, linked to activation of the PKC pathway. (C) 2010 Elsevier Inc. All rights reserved.

Glucocorticoids in Vivo Induce Both Insulin Hypersecretion and Enhanced Glucose Sensitivity of Stimulus-Secretion Coupling in Isolated Rat Islets

Although glucocorticoids are widely used as antiinflammatory agents in clinical therapies, they may cause serious side effects that include insulin resistance and hyperinsulinemia. To study the potential functional adaptations of the islet of Langerhans to in vivo glucocorticoid treatment, adult Wistar rats received dexamethasone (DEX) for 5 consecutive days, whereas controls (CTL) received only saline. The analysis of insulin release in freshly isolated islets showed an enhanced secretion in response to glucose in DEX-treated rats. The study of Ca(2+) signals by fluorescence microscopy also demonstrated a higher response to glucose in islets from DEX-treated animals. However, no differences in Ca(2+) signals were found between both groups with tolbutamide or KCl, indicating that the alterations were probably related to metabolism. Thus, mitochondrial function was explored by monitoring oxidation of nicotinamide dinucleotide phosphate autofluorescence and mitochondrial membrane potential. Both parameters revealed a higher response to glucose in islets from DEX-treated rats. The mRNA and protein content of glucose transporter-2, glucokinase, and pyruvate kinase was similar in both groups, indicating that changes in these proteins were probably not involved in the increased mitochondrial function. Additionally, we explored the status of Ca(2+)-dependent signaling kinases. Unlike calmodulin kinase II, we found an augmented phosphorylation level of protein kinase C alpha as well as an increased response of the phospholipase C/inositol 1,4,5-triphosphate pathway in DEX-treated rats. Finally, an increased number of docked secretory granules were observed in the beta-cells of DEX animals using transmission electron microscopy. Thus, these results demonstrate that islets from glucocorticoid-treated rats develop several adaptations that lead to an enhanced stimulus-secretion coupling and secretory capacity. (Endocrinology 151: 85-95, 2010)

Does the TL supralinearity occur during irradiation in alkali halides?

In the last ten to fifteen years, there has been a predominant belief that the linear-supralinear-sublinear behaviour of the TL response of alkali halides to the radiation dose necessarily occurs in the heating stage for TL reading. It is based on the assumption that coloration in these crystals grows linear-sublinearly with the dose during irradiation. Since both colour centre and TL centre are based on the same point defects the TL response should also grow linear-sublinearly with dose. In 1950, half a dozen authors showed that the coloration of F-centres in KCl takes place in two stages, the second one being responsible for non-linear behaviour. In this paper, we show that indeed in NaCl both F-centre and TL grow linear-supralinear-sublinearly with the dose during irradiation.

Mineralogical and microthermometric studies and structural aspects of imperial topaz mineralization in Antonio Pereira, Ouro Preto District (Minas Gerais) - Brazil

The occurrences of imperial topaz in the Antonio Pereira mine, Ouro Preto, Minas Gerais, are associated with the metamorphic carbonate rocks of the Minas Supergroup. The crystals have densities varying from 3.46 to 3.58. The parameters of the unitary cells obtained were: 4.658 to 4.663 angstrom (ao), 8.823 to 8.832 angstrom (b(o)), 8.382 to 8.389 angstrom (c(o)), and 344.65 to 345.46 angstrom 3 (V). The refraction indices presented the following variations: 1.622 to 1.630 (nX), 1.624 to 1.632 (nY), 1.633 to 1.640 (nZ), and 0.008 to 0.011 (B). These properties are coherent with the low fluorine contents obtained (16,48%/17,05wt%). Infrared spectroscopy and microthermometry showed that the fluid inclusions, which represent the mineralizing fluids, are formed by H(2)O (with Ca(2+), Mg(2+) and Na(+)), and CO(2) +/- CH(4). The minimal trapping T-P conditions of 290/320 degrees C and 2,349/2,497bar were obtained for the primary fluid inclusions. The pseudo-secondary fluid inclusions were trapped at conditions of lower temperatures and variable pressures, during the deformation process under local alternating states of stress. The microthermometric studies, the structural analysis and the fluorine contents suggest that the mineralized veins were formed from hydrothermal fluids originated during the Brasiliano tectono-metamorphic event.

cis-4-decenoic acid provokes mitochondrial bioenergetic dysfunction in rat brain

Aims: In the present work we investigated the in vitro effect of cis-4-decenoic acid, the pathognomonic metabolite of medium-chain acyl-CoA dehydrogenase deficiency, on various parameters of bioenergetic homeostasis in rat brain mitochondria. Main methods: Respiratory parameters determined by oxygen consumption were evaluated, as well as membrane potential, NAD(P)H content, swelling and cytochrome c release in mitochondrial preparations from rat brain, using glutamate plus malate or succinate as substrates. The activities of citric acid cycle enzymes were also assessed. Key findings: cis-4-decenoic acid markedly increased state 4 respiration, whereas state 3 respiration and the respiratory control ratio were decreased. The ADP/O ratio, the mitochondrial membrane potential, the matrix NAD(P)H levels and aconitase activity were also diminished by cis-4-decenoic acid. These data indicate that this fatty acid acts as an uncoupler of oxidative phosphorylation and as a metabolic inhibitor. cis-4-decenoic acid also provoked a marked mitochondrial swelling when either KCl or sucrose was used in the incubation medium and also induced cytochrome c release from mitochondria, suggesting a non-selective permeabilization of the inner mitochondria! membrane. Significance: It is therefore presumed that impairment of mitochondrial homeostasis provoked by cis-4-decenoic acid may be involved in the brain dysfunction observed in medium-chain acyl-CoA dehydrogenase deficient patients. (C) 2010 Elsevier Inc. All rights reserved.

Flow injection amperometric determination of hydrogen peroxide in household commercial products with a ruthenium oxide hexacyanoferrate modified electrode

Hydrogen peroxide was determined in oral antiseptic and bleach samples using a flow-injection system with amperometric detection. A glassy carbon electrode modified by electrochemical deposition of ruthenium oxide hexacyanoferrate was used as working electrode and a homemade Ag/AgCl (saturated KCl) electrode and a platinum wire were used as reference and counter electrodes, respectively. The electrocatalytic reduction process allowed the determination of hydrogen peroxide at 0.0 V. A linear relationship between the cathodic peak current and concentration of hydrogen peroxide was obtained in the range 10-5000 mu mol L(-1) with detection and quantification limits of 1.7 (S/N = 3) and 5.9 (S/N = 10) mu mol L(-1), respectively. The repeatability of the method was evaluated using a 500 mu mol L(-1) hydrogen peroxide solution, the value obtained being 1.6% (n = 14). A sampling rate of 112 samples h(-1) was achieved at optimised conditions. The method was employed for the quantification of hydrogen peroxide in two commercial samples and the results were in agreement with those obtained by using a recommended procedure.