983 resultados para Dna Identification
Resumo:
Recognition and identification processes for deceased persons. Determining the identity of deceased persons is a routine task performed essentially by police departments and forensic experts. This thesis highlights the processes necessary for the proper and transparent determination of the civil identities of deceased persons. The identity of a person is defined as the establishment of a link between that person ("the source") and information pertaining to the same individual ("identifiers"). Various identity forms could emerge, depending on the nature of the identifiers. There are two distinct types of identity, namely civil identity and biological identity. The paper examines four processes: identification by witnesses (the recognition process) and comparisons of fingerprints, dental data and DNA profiles (the identification processes). During the recognition process, the memory function is examined and helps to clarify circumstances that may give rise to errors. To make the process more rigorous, a body presentation procedure is proposed to investigators. Before examining the other processes, three general concepts specific to forensic science are considered with regard to the identification of a deceased person, namely, matter divisibility (Inman and Rudin), transfer (Locard) and uniqueness (Kirk). These concepts can be applied to the task at hand, although some require a slightly broader scope of application. A cross comparison of common forensic fields and the identification of deceased persons reveals certain differences, including 1 - reverse positioning of the source (i.e. the source is not sought from traces, but rather the identifiers are obtained from the source); 2 - the need for civil identity determination in addition to the individualisation stage; and 3 - a more restricted population (closed set), rather than an open one. For fingerprints, dental and DNA data, intravariability and intervariability are examined, as well as changes in these post mortem (PM) identifiers. Ante-mortem identifiers (AM) are located and AM-PM comparisons made. For DNA, it has been shown that direct identifiers (taken from a person whose civil identity has been alleged) tend to lead to determining civil identity whereas indirect identifiers (obtained from a close relative) direct towards a determination of biological identity. For each process, a Bayesian model is presented which includes sources of uncertainty deemed to be relevant. The results of the different processes combine to structure and summarise an overall outcome and a methodology. The modelling of dental data presents a specific difficulty with respect to intravariability, which in itself is not quantifiable. The concept of "validity" is, therefore, suggested as a possible solution to the problem. Validity uses various parameters that have an acknowledged impact on teeth intravariability. In cases where identifying deceased persons proves to be extremely difficult due to the limited discrimination of certain procedures, the use of a Bayesian approach is of great value in bringing a transparent and synthetic value. RESUME : Titre: Processus de reconnaissance et d'identification de personnes décédées. L'individualisation de personnes décédées est une tâche courante partagée principalement par des services de police, des odontologues et des laboratoires de génétique. L'objectif de cette recherche est de présenter des processus pour déterminer valablement, avec une incertitude maîtrisée, les identités civiles de personnes décédées. La notion d'identité est examinée en premier lieu. L'identité d'une personne est définie comme l'établissement d'un lien entre cette personne et des informations la concernant. Les informations en question sont désignées par le terme d'identifiants. Deux formes distinctes d'identité sont retenues: l'identité civile et l'identité biologique. Quatre processus principaux sont examinés: celui du témoignage et ceux impliquant les comparaisons d'empreintes digitales, de données dentaires et de profils d'ADN. Concernant le processus de reconnaissance, le mode de fonctionnement de la mémoire est examiné, démarche qui permet de désigner les paramètres pouvant conduire à des erreurs. Dans le but d'apporter un cadre rigoureux à ce processus, une procédure de présentation d'un corps est proposée à l'intention des enquêteurs. Avant d'entreprendre l'examen des autres processus, les concepts généraux propres aux domaines forensiques sont examinés sous l'angle particulier de l'identification de personnes décédées: la divisibilité de la matière (Inman et Rudin), le transfert (Locard) et l'unicité (Kirk). Il est constaté que ces concepts peuvent être appliqués, certains nécessitant toutefois un léger élargissement de leurs principes. Une comparaison croisée entre les domaines forensiques habituels et l'identification de personnes décédées montre des différences telles qu'un positionnement inversé de la source (la source n'est plus à rechercher en partant de traces, mais ce sont des identifiants qui sont recherchés en partant de la source), la nécessité de devoir déterminer une identité civile en plus de procéder à une individualisation ou encore une population d'intérêt limitée plutôt qu'ouverte. Pour les empreintes digitales, les dents et l'ADN, l'intra puis l'inter-variabilité sont examinées, de même que leurs modifications post-mortem (PM), la localisation des identifiants ante-mortem (AM) et les comparaisons AM-PM. Pour l'ADN, il est démontré que les identifiants directs (provenant de la personne dont l'identité civile est supposée) tendent à déterminer une identité civile alors que les identifiants indirects (provenant d'un proche parent) tendent à déterminer une identité biologique. Puis une synthèse des résultats provenant des différents processus est réalisée grâce à des modélisations bayesiennes. Pour chaque processus, une modélisation est présentée, modélisation intégrant les paramètres reconnus comme pertinents. À ce stade, une difficulté apparaît: celle de quantifier l'intra-variabilité dentaire pour laquelle il n'existe pas de règle précise. La solution préconisée est celle d'intégrer un concept de validité qui intègre divers paramètres ayant un impact connu sur l'intra-variabilité. La possibilité de formuler une valeur de synthèse par l'approche bayesienne s'avère d'une aide précieuse dans des cas très difficiles pour lesquels chacun des processus est limité en termes de potentiel discriminant.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
The ability of a PCR-based restriction fragment length polymorphism (RFLP) analysis of the cytochrome b (mtDNA) to distinguish Apodemus alpicola from two other Apodemus species was investigated. The partial sequencing of the cytochrome b allowed the identification of one enzyme as being potentially diagnostic. This was supported by an analysis of 131 specimens previously identified using morphometric and/or allozymic data, indicating that the PCR-based RFLP method provides a rapid and reliable tool for distinguishing A. alpicola from its two co-occurring congenerics. The method is applicable to samples taken in the field for ecological studies, and could easily be adapted to the identification of museum samples.
Resumo:
The objectives of this work were to evaluate the frequency of polyembryony, and to identify zygotic and nucellar seedlings of Citrus volkameriana using RAPD. Twenty-five polyembryonic and eight monoembryonic seeds were cultivated in vitrofor six months. DNA from seedlings was extracted and used in combination with five RAPD primers to identify zygotic or nucellar origin of the seedlings. Environmental conditions of the year affected significantly (P<0.05) the morphological characteristics of fruitsand the number ofembryos per seed. Polyembryonic seeds ranged from 30.9%, 44.8% to 54.4% over three years. Morphological characteristic was not correlated with polyembryony. In vitro culture enable all embryos of each seed to grow, favoring the percentage of seedlings identified as zygotic. In polyembryonic and monoembryonic seeds, 25.9% and 87.5% of the seedlings, respectively, were sexually originated. In polyembryonic seeds, not all zygotic seedlings were produced by small embryos located at the micropyle.
Resumo:
The objective of this work was to identify genomic regions that underlie resistance to Fusarium tucumaniae sp. nov., the causing agent of sudden death syndrome (SDS) in soybean in South America, using a population with a genetic background different from that previously reported for Fusarium virguliforme sp. nov. (F. solani f. sp. glycines), also responsible for SDS in soybean. Although major genes and quantitative trait loci (QTL) for SDS resistance have been identified, little is known about the same disease caused by Fusarium tucumaniae sp. nov., in South America. To identify genetic factors related to resistance to F. tucumaniae and DNA markers associated with them, a QTL analysis was performed using recombinant inbred lines. The map locations of the four loci, here identified, differed from those SDS resistance QTL previously described. It was screened a residual heterozygous line (RHL), which was heterozygous around the most effective QTL, RSDS1, and homozygous for the other genomic regions. The genetic effect of RSDS1 was confirmed using near-isogenic lines (NIL) derived from the RHL. The line which was homozygous for the Misuzudaizu genotype showed resistance levels comparable with that of the line homozygous for the Moshidou Gong 503 genotype.
Resumo:
Background: Mantle cell lymphoma (MCL) is genetically characterized by the t(11;14)(q13;q32) translocation and a high number of secondary chromosomal alterations. The contribution of DNA methylation to MCL lymphomagenesis is not well known. We sought to identify epigenetically silenced genes in these tumours that might have clinical relevance. Methodology/Principal Findings: To identify potential methylated genes in MCL we initially investigated seven MCL cell lines treated with epigenetic drugs and gene expression microarray profiling. The methylation status of selected candidate genes was validated by a quantitative assay and subsequently analyzed in a series of primary MCL (n=38). After pharmacological reversion we identified 252 potentially methylated genes. The methylation analysis of a subset of these genes (n=25) in the MCL cell lines and normal B lymphocytes confirmed that 80% of them were methylated in the cell lines but not in normal lymphocytes. The subsequent analysis in primary MCL identified five genes (SOX9,HOXA9,AHR,NR2F2 ,and ROBO1) frequently methylated in these tumours. The gene methylation events tended to occur in the same primary neoplasms and correlated with higher proliferation, increased number of chromosomal abnormalities, and shorter survival of the patients. Conclusions: We have identified a set of genes whose methylation degree and gene expression levels correlate with aggressive clinicopathological features of MCL. Our findings also suggest that a subset of MCL might show a CpG island methylator phenotype (CIMP) that may influence the behaviour of the tumours.
Resumo:
Rapport de synthèse Objectifs : Évaluer l'impact clinique de femmes infectées par de multiples papillomavirus human (HPV) à haut risque dont le HPV 16 en comparaison de l'évolution de femmes infectées par du HPV 16 seul. Méthode : 169 femmes ont été classifiées en trois groupes, dépendant de leur profile HPV: HPV-16 seul, HPV-16 et un HPV de type bas risque, HPV-16 et un autre HPV à haut risque. Le HPV-DNA des frottis cervicaux a été analysé par polymerase chain reaction (PCR) et reverse line blot hybridization (RLBH). Toutes les femmes ont été suivies à la consultation de colposcopie pour une durée de 24 mois ou plus. La prise en charge s'est faite selon les recommandations de Bethesda. Résultats : Les femmes infectées par du HPV 16 et un autre HPV à haut risque n'ont présenté aucun changement voire une progression de leur dysplasie en comparaison des femmes des autres groupes (RR: 1.39; 95%CI: 1.07 à 1.82; p value: 0.02 à 6 mois; RR: 2.10; 95%CI: 1.46 à 3.02; p value: <0.001 à 12 mois; RR: 1.82; 95%CI: 1.21 à 2.72; p value: 0.004 à 24 mois). Conclusions : Les femmes présentant une co-infection par du HPV 16 ainsi qu'un autre HPV de haut risque voient leur risque d'évolution défavorable augmenter.
Resumo:
The biodiversity of soil communities remains very poorly known and understood. Soil biological sciences are strongly affected by the taxonomic crisis, and most groups of animals in that biota suffer from a strong taxonomic impediment. The objective of this work was to investigate how DNA barcoding - a novel method using a microgenomic tag for species identification and discrimination - permits better evaluation of the taxonomy of soil biota. A total of 1,152 barcode sequences were analyzed for two major groups of animals, collembolans and earthworms, which presented broad taxonomic and geographic sampling. Besides strongly reflecting the taxonomic impediment for both groups, with a large number of species-level divergent lineages remaining unnamed so far, the results also highlight a high level (15%) of cryptic diversity within known species of both earthworms and collembolans. These results are supportive of recent local studies using a similar approach. Within an impeded taxonomic system for soil animals, DNA-assisted identification tools can facilitate and improve biodiversity exploration and description. DNA-barcoding campaigns are rapidly developing in soil animals and the community of soil biologists is urged to embrace these methods.
Resumo:
The objective of this work was to evaluate a set of microsatellite markers for varietal identification and characterization of the most widespread potato cultivars in Brazil. The DNA from 14 potato cultivars was genotyped using microsatellite markers and the alleles were scored in silver-stained polyacrylamide gel. Twenty-four microsatellite markers were evaluated, and only one locus was monomorphic. Based on band patterns, a set of two microsatellites that were able to identify and differentiate all examined cultivars was obtained.
Resumo:
Land plants have had the reputation of being problematic for DNA barcoding for two general reasons: (i) the standard DNA regions used in algae, animals and fungi have exceedingly low levels of variability and (ii) the typically used land plant plastid phylogenetic markers (e.g. rbcL, trnL-F, etc.) appear to have too little variation. However, no one has assessed how well current phylogenetic resources might work in the context of identification (versus phylogeny reconstruction). In this paper, we make such an assessment, particularly with two of the markers commonly sequenced in land plant phylogenetic studies, plastid rbcL and internal transcribed spacers of the large subunits of nuclear ribosomal DNA (ITS), and find that both of these DNA regions perform well even though the data currently available in GenBank/EBI were not produced to be used as barcodes and BLAST searches are not an ideal tool for this purpose. These results bode well for the use of even more variable regions of plastid DNA (such as, for example, psbA-trnH) as barcodes, once they have been widely sequenced. In the short term, efforts to bring land plant barcoding up to the standards being used now in other organisms should make swift progress. There are two categories of DNA barcode users, scientists in fields other than taxonomy and taxonomists. For the former, the use of mitochondrial and plastid DNA, the two most easily assessed genomes, is at least in the short term a useful tool that permits them to get on with their studies, which depend on knowing roughly which species or species groups they are dealing with, but these same DNA regions have important drawbacks for use in taxonomic studies (i.e. studies designed to elucidate species limits). For these purposes, DNA markers from uniparentally (usually maternally) inherited genomes can only provide half of the story required to improve taxonomic standards being used in DNA barcoding. In the long term, we will need to develop more sophisticated barcoding tools, which would be multiple, low-copy nuclear markers with sufficient genetic variability and PCR-reliability; these would permit the detection of hybrids and permit researchers to identify the 'genetic gaps' that are useful in assessing species limits.
Resumo:
BACKGROUND: DNA sequence polymorphisms analysis can provide valuable information on the evolutionary forces shaping nucleotide variation, and provides an insight into the functional significance of genomic regions. The recent ongoing genome projects will radically improve our capabilities to detect specific genomic regions shaped by natural selection. Current available methods and software, however, are unsatisfactory for such genome-wide analysis. RESULTS: We have developed methods for the analysis of DNA sequence polymorphisms at the genome-wide scale. These methods, which have been tested on a coalescent-simulated and actual data files from mouse and human, have been implemented in the VariScan software package version 2.0. Additionally, we have also incorporated a graphical-user interface. The main features of this software are: i) exhaustive population-genetic analyses including those based on the coalescent theory; ii) analysis adapted to the shallow data generated by the high-throughput genome projects; iii) use of genome annotations to conduct a comprehensive analyses separately for different functional regions; iv) identification of relevant genomic regions by the sliding-window and wavelet-multiresolution approaches; v) visualization of the results integrated with current genome annotations in commonly available genome browsers. CONCLUSION: VariScan is a powerful and flexible suite of software for the analysis of DNA polymorphisms. The current version implements new algorithms, methods, and capabilities, providing an important tool for an exhaustive exploratory analysis of genome-wide DNA polymorphism data.
Resumo:
The objective of this work was to evaluate the occurrence of polyembryony in the mango cultivars Manila and Ataulfo, and to determine whether seedlings cultured in vitro are zygotic or nucelar. Percentage of polyembryony was calculated and the number of embryos in 100 seeds of each cultivar was recorded. 'Manila' exhibited 97% polyembryony with 3.4 embryos per seed, while 'Ataulfo' had 95% polyembryony with 3.2 embryos per seed. Later, 20 seeds of each cultivar were established in vitro, and it was analyzed those in which all embryos germinated (12 seeds from 'Manila' and 7 from 'Ataulfo'). DNA was extracted from seedling leaf tissue, and its origin was identified with 14 RAPD primers. The polymorphic markers recognized the seedlings of sexual origin in seven of nine 'Manila' polyembryonic seeds, and in four of seven 'Ataulfo' ones. Also, in polyembryonic seeds not all zygotic seedlings were produced by small embryos located at the micropyle.
Resumo:
Massively parallel signature sequencing (MPSS) generates millions of short sequence tags corresponding to transcripts from a single RNA preparation. Most MPSS tags can be unambiguously assigned to genes, thereby generating a comprehensive expression profile of the tissue of origin. From the comparison of MPSS data from 32 normal human tissues, we identified 1,056 genes that are predominantly expressed in the testis. Further evaluation by using MPSS tags from cancer cell lines and EST data from a wide variety of tumors identified 202 of these genes as candidates for encoding cancer/testis (CT) antigens. Of these genes, the expression in normal tissues was assessed by RT-PCR in a subset of 166 intron-containing genes, and those with confirmed testis-predominant expression were further evaluated for their expression in 21 cancer cell lines. Thus, 20 CT or CT-like genes were identified, with several exhibiting expression in five or more of the cancer cell lines examined. One of these genes is a member of a CT gene family that we designated as CT45. The CT45 family comprises six highly similar (>98% cDNA identity) genes that are clustered in tandem within a 125-kb region on Xq26.3. CT45 was found to be frequently expressed in both cancer cell lines and lung cancer specimens. Thus, MPSS analysis has resulted in a significant extension of our knowledge of CT antigens, leading to the discovery of a distinctive X-linked CT-antigen gene family.
Resumo:
RESUME La télomérase confère une durée de vie illimitée et est réactivée dans la plupart des cellules tumorales. Sa sous-unité catalytique hTERT est définie comme le facteur limitant pour son activation. De l'identification de facteurs liant la région régulatrice d'hTERT, au rôle de la méthylation de l'ADN et de la modification des histones, de nombreux modèles de régulation ont été suggérés. Cependant, aucun de ces modèles n'a pu expliquer l'inactivation de la télomérase dans la plupart des cellules somatiques et sa réactivation dans la majorité des cellules tumorales. De plus, les observations contradictoires entre le faible niveau d'expression d'ARN messager d'hTERT dans les cellules télomérase-positives et la très forte activité transcriptionnelle du promoteur d'hTERT en transfection restent incomprises. Dans cette étude, nous avons montré que la région proximale du gène hTERT (exon 1 et 2) était impliquée dans la répression de l'activité de son promoteur. Nous avons identifié le facteur CTCF comme étant un inhibiteur du promoteur d'hTERT, en se liant au niveau de son premier exon. La méthylation de l'exon 1 du gène hTERT, couramment observée dans les tumeurs mais pas dans les cellules normales, empêcherait la liaison de CTCF. L'étude du profil de méthylation du promoteur d'hTERT indique qu'une partie du promoteur reste déméthylée et qu'elle semble suffisante pour permettre une faible activité transcriptionnelle du gène hTERT. Ainsi, la méthylation particulière des régions régulatrices d'hTERT inhibe la liaison de CTCF tout en permettant une faible transcription du gène. Cependant, dans certaines cellules tumorales, le promoteur et la région proximale du gène hTERT ne sont pas méthylés. Dans les lignées cellulaires tumorales de tesitcules et d'ovaires, l'inhibition de CTCF est contrée par son paralogue BORIS, qui se lie aussi au niveau de l'exon 1 d'hTERT, mais permet ainsi l'activation du promoteur. L'étude de l'expression du gène BORIS montre qu'il est exclusivement exprimé dans les tissus normaux de testicules et d'ovaires jeunes, ainsi qu'à différents niveaux dans la plupart des tumeurs. Sa transcription est sous le contrôle de deux promoteurs. Le promoteur proximal est régulé par méthylation et un transcrit alternatif majoritaire, délété de l'exon 6, est trouvé lorsque ce promoteur est actif. Tous ces résultats conduisent à un modèle de régulation du gène hTERT qui tient compte du profil épigénétique du gène et qui permet d'expliquer le faible taux de transcription observé in vivo. De plus, l'expression de BORIS dans les cancers et son implication dans l'activation du gène hTERT pourrait permettre de comprendre les phénomènes de dérégulation épigénétique et d'immortalisation qui ont lieu durant la tumorigenèse. SUMMARY Telomerase confers an unlimited lifespan, and is reactivated in most tumor cells. The catalytic subunit of telomerase, hTERT, is defined as the limiting factor for telomerase activity. Between activators and repressors that bind to the hTERT 5' regulatory region, and the role of CpG methylation and histone acetylation, an abundance of regulatory models have been suggested. None of these models can explain the silence of telomerase in most somatic cells and its reactivation in tumor cells. Moreover, the contradictory observations of the low level of hTERT mRNA in telomerase-positive cells and the high transcriptional activity of the hTERT promoter in transfection experiments remain unresolved. In this study, we demonstrated that the proximal exonic region of the hTERT gene (exon 1 and 2) is involved in the inhibition of its promoter. We identified the protein CTCF as the inhibitor of the hTERT promoter, through its binding to the first exon. The methylation of the first exon region, which is often observed in cancer cells but not in noimal cells, represses CTCF binding. Study of hTERT promoter methylation shows a partial demethylation sufficient to activate the transcription of the hTERT gene. Therefore, we demonstrated that the particular methylation profile of the hTERT regulatory sequences inhibits the binding of CTCF, while it allows a low transcription of the gene. Nevertheless, in some tumor cells, the promoter and the proximal exonic region of hTERT are unmethylated. In testicular and ovarian cancer cell lines, CTCF inhibition is counteracted by its BORIS paralogue that also binds the hTERT first exon but allows the promoter activation. The study of BORIS gene regulation showed that this factor is exclusively expressed in normal tissue of testis and ovary of young woman, as well as in almost all tumors with different levels. Two promoters were found to induce its transcription. The proximal promoter was regulated by methylation. Moreover, a major alternative transcript, deleted of the exon 6, is detected when this promoter is active. All these results lead to a model for hTERT regulation that takes into account the epigenetic profile of the gene and provides an explanation for the low transcriptional level observed in vivo. BORIS expression in cancers and its implication in hTERT activation might also permit the understanding of epigenetic deregulation and immortalization phenomena that occur during tumorigenesis.
Resumo:
Mango can be propagated by seeds or by grafting. For commercial purpose, grafting is the most appropriate method because it maintains the genetic characters from the propagated variety. To obtain grafted mango it is important to use polyembryonic varieties as rootstock since they produce a zygotic and many nucellar plantlets. The nucellar plantlets maintain the genetics of the mother-plant thus, are preferred for grafting since they supposedly give more uniformity to the orchard. In general, nurserymen use the most vigorous plantelet to graft, believing that they are nucellar. But, orchard disuniformities on height and yield are very common among mango trees of commercial orchards in Northeast region. The objective of this paper was to identify the genetical origin of plantlets from polyembryonic seeds of Rosinha variety using Random Amplified Polymorphic DNA (RAPD) markers. Moreover, the position of the zygotic embryo and the percentage of the vigorous zygotic and nucellar plantlets was also determined. It was obtained an elevated taxa of vigorous zygotic plantlets which possibly explains the disuniformity on height of trees at commercial mango orchards.