Land-use systems affect Archaeal community structure and functional diversity in western Amazon soils

The study of the ecology of soil microbial communities at relevant spatial scales is primordial in the wide Amazon region due to the current land use changes. In this study, the diversity of the Archaea domain (community structure) and ammonia-oxidizing Archaea (richness and community composition) were investigated using molecular biology-based techniques in different land-use systems in western Amazonia, Brazil. Soil samples were collected in two periods with high precipitation (March 2008 and January 2009) from Inceptisols under primary tropical rainforest, secondary forest (5-20 year old), agricultural systems of indigenous people and cattle pasture. Denaturing gradient gel electrophoresis of polymerase chain reaction-amplified DNA (PCR-DGGE) using the 16S rRNA gene as a biomarker showed that archaeal community structures in crops and pasture soils are different from those in primary forest soil, which is more similar to the community structure in secondary forest soil. Sequence analysis of excised DGGE bands indicated the presence of crenarchaeal and euryarchaeal organisms. Based on clone library analysis of the gene coding the subunit of the enzyme ammonia monooxygenase (amoA) of Archaea (306 sequences), the Shannon-Wiener function and Simpson's index showed a greater ammonia-oxidizing archaeal diversity in primary forest soils (H' = 2.1486; D = 0.1366), followed by a lower diversity in soils under pasture (H' = 1.9629; D = 0.1715), crops (H' = 1.4613; D = 0.3309) and secondary forest (H' = 0.8633; D = 0.5405). All cloned inserts were similar to the Crenarchaeota amoA gene clones (identity > 95 %) previously found in soils and sediments and distributed primarily in three major phylogenetic clusters. The findings indicate that agricultural systems of indigenous people and cattle pasture affect the archaeal community structure and diversity of ammonia-oxidizing Archaea in western Amazon soils.

Fine structure of the vaccinia virus gene encoding the precursor of the major core protein 4 a.

A 6008 base pair fragment of the vaccinia virus DNA containing the gene for the precursor of the major core protein 4 a, which has been designated P4 a, was sequenced. A long open reading frame (ORF) encoding a protein of molecular weight 102,157 started close to the position where the P4 a mRNA had been mapped. Analysis of the mRNA by S1 nuclease mapping and primer extension indicated that the 5' end defined by the former method is not the true 5' end. This suggests that the P4 a coding region is preceded by leader sequences that are not derived from the immediate vicinity of the gene, similar to what has been reported for another late vaccinia virus mRNA. The sequenced DNA contained several further ORFs on the same, or opposite DNA strand, providing further evidence for the close spacing of protein-coding sequences in the viral genome.

Counter-ion effect on surfactant-DNA gel particles as controlled DNA delivery systems

The ability to entrap drugs within vehicles and subsequently release them has led to new treatments for a number of diseases. Based on an associative phase separation and interfacial diffusion approach, we developed a way to prepare DNA gel particles without adding any kind of cross-linker or organic solvent. Among the various agents studied, cationic surfactants offered particularly efficient control for encapsulation and DNA release from these DNA gel particles. The driving force for this strong association is the electrostatic interaction between the two components, as induced by the entropic increase due to the release of the respective counter-ions. However, little is known about the influence of the respective counter-ions on this surfactant-DNA interaction. Here we examined the effect of different counter-ions on the formation and properties of the DNA gel particles by mixing DNA (either single- (ssDNA) or double-stranded (dsDNA)) with the single chain surfactant dodecyltrimethylammonium (DTA). In particular, we used as counter-ions of this surfactant the hydrogen sulfate and trifluoromethane sulfonate anions and the two halides, chloride and bromide. Effects on the morphology of the particles obtained, the encapsulation of DNA and its release, as well as the haemocompatibility of these particles, are presented, using the counter-ion structure and the DNA conformation as controlling parameters. Analysis of the data indicates that the degree of counter-ion dissociation from the surfactant micelles and the polar/hydrophobic character of the counter-ion are important parameters in the final properties of the particles. The stronger interaction with amphiphiles for ssDNA than for dsDNA suggests the important role of hydrophobic interactions in DNA.

Spatio-temporal population genetic structure of the parasitic mite Spinturnix bechsteini is shaped by its own demography and the social system of its bat host.

Information about the population genetic structures of parasites is important for an understanding of parasite transmission pathways and ultimately the co-evolution with their hosts. If parasites cannot disperse independently of their hosts, a parasite's population structure will depend upon the host's spatial distribution. Geographical barriers affecting host dispersal can therefore lead to structured parasite populations. However, how the host's social system affects the genetic structure of parasite populations is largely unknown. We used mitochondrial DNA (mtDNA) to describe the spatio-temporal population structure of a contact-transmitted parasitic wing mite (Spinturnix bechsteini) and compared it to that of its social host, the Bechstein's bat (Myotis bechsteinii). We observed no genetic differentiation between mites living on different bats within a colony. This suggests that mites can move freely among bats of the same colony. As expected in case of restricted inter-colony dispersal, we observed a strong genetic differentiation of mites among demographically isolated bat colonies. In contrast, we found a strong genetic turnover between years when we investigated the temporal variation of mite haplotypes within colonies. This can be explained with mite dispersal occuring between colonies and bottlenecks of mite populations within colonies. The observed absence of isolation by distance could be the result from genetic drift and/or from mites dispersing even between remote bat colonies, whose members may meet at mating sites in autumn or in hibernacula in winter. Our data show that the population structure of this parasitic wing mite is influenced by its own demography and the peculiar social system of its bat host.

Scale-specific sex-biased dispersal in the Valais shrew unveiled by genetic variation on the Y chromosome, autosomes, and mitochondrial DNA.

We investigated sex specificities in the evolutionary processes shaping Y chromosome, autosomes, and mitochondrial DNA patterns of genetic structure in the Valais shrew (Sorex antinorii), a mountain dwelling species with a hierarchical distribution. Both hierarchical analyses of variance and isolation-by-distance analyses revealed patterns of population structure that were not consistent across maternal, paternal, and biparentally inherited markers. Differentiation on a Y microsatellite was lower than expected from the comparison with autosomal microsatellites and mtDNA, and it was mostly due to genetic variance among populations within valleys, whereas the opposite was observed on other markers. In addition, there was no pattern of isolation by distance for the Y, whereas there was strong isolation by distance on mtDNA and autosomes. We use a hierarchical island model of coancestry dynamics to discuss the relative roles of the microevolutionary forces that may induce such patterns. We conclude that sex-biased dispersal is the most important driver of the observed genetic structure, but with an intriguing twist: it seems that dispersal is strongly male biased at large spatial scale, whereas it is mildly biased in favor of females at local scale. These results add to recent reports of scale-specific sex-biased dispersal patterns, and emphasize the usefulness of the Y chromosome in conjunction with mtDNA and autosomes to infer sex specificities.

Soil tillage affects the community structure of mycorrhizal fungi in maize roots

In this study we tested whether communities of arbuscular mycorrhizal fungi (AMF) colonizing the roots of maize (Zea mays L.) were affected by soil tillage practices (plowing, chiseling, and no-till) in a long-term field experiment carried out in Tanikon (Switzerland). AMF were identified in the roots using specific polymerase chain reaction (PCR) markers that had been developed for the AMF previously isolated from the soils of the studied site. A nested PCR procedure with primers of increased specificity (eukaryotic, then, fungal, then AMF species or. species-grouop specific) was used. Sequencing of amplified DNA confirmed that the DNA obtained from the maize roots was of AMF origin. Presence of particular AMF species or species-group was scored as a presence of a DNA product after PCR with specific primers. We also used single-strand conformation polymorphism analysis (SSCP), of amplified DNA samples to-check if the amplification of the DNA from maize roots matched the expected profile for a particular AMF isolate with a given specific primer pair. Presence of the genus Scutellospora, in maize roots was strongly reduced in plowed and chiseled soils. Fungi from the suborder Glomineae were more prevalent colonizers of maize roots growing in plowed soils, but were also present in the roots from other tillage treatments. These changes in community of AMF colonizing maize roots might be due to (1), the differences in tolerance to the tillage-induced disruption of the hyphae among the different AMF species, (2) changes in nutrient content of the soil, (3) changes in microbial activity, or (4) changes in weed populations in response to soil tillage. This is the first report on community composition of AMF in the roots of a field-grown crop plant (maize) as affected by soil tillage.

An integrated encyclopedia of DNA elements in the human genome.

The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research.

Origin and evolution of homologous repeated sequences in the mitochondrial DNA control region of shrews.

The complete mitochondrial DNA (mtDNA) control region was amplified and directly sequenced in two species of shrew, Crocidura russula and Sorex araneus (Insectivora, Mammalia). The general organization is similar to that found in other mammals: a central conserved region surrounded by two more variable domains. However, we have found in shrews the simultaneous presence of arrays of tandem repeats in potential locations where repeats tend to occur separately in other mammalian species. These locations correspond to regions which are associated with a possible interruption of the replication processes, either at the end of the three-stranded D-loop structure or toward the end of the heavy-strand replication. In the left domain the repeated sequences (R1 repeats) are 78 bp long, whereas in the right domain the repeats are 12 bp long in C. russula and 14 bp long in S. araneus (R2 repeats). Variation in the copy number of these repeated sequences results in mtDNA control region length differences. Southern blot analysis indicates that level of heteroplasmy (more than one mtDNA form within an individual) differs between species. A comparative study of the R2 repeats in 12 additional species representing three shrew subfamilies provides useful indications for the understanding of the origin and the evolution of these homologous tandemly repeated sequences. An asymmetry in the distribution of variants within the arrays, as well as the constant occurrence of shorter repeated sequences flanking only one side of the R2 arrays, could be related to asymmetry in the replication of each strand of the mtDNA molecule. The pattern of sequence and length variation within and between species, together with the capability of the arrays to form stable secondary structures, suggests that the dominant mechanism involved in the evolution of these arrays in unidirectional replication slippage.

Phylogeography and Pleistocene refugia of the adder (Vipera berus) as inferred from mitochondrial DNA sequence data.

In order to contribute to the debate about southern glacial refugia used by temperate species and more northern refugia used by boreal or cold-temperate species, we examined the phylogeography of a widespread snake species (Vipera berus) inhabiting Europe up to the Arctic Circle. The analysis of the mitochondrial DNA (mtDNA) sequence variation in 1043 bp of the cytochrome b gene and in 918 bp of the noncoding control region was performed with phylogenetic approaches. Our results suggest that both the duplicated control region and cytochrome b evolve at a similar rate in this species. Phylogenetic analysis showed that V. berus is divided into three major mitochondrial lineages, probably resulting from an Italian, a Balkan and a Northern (from France to Russia) refugial area in Eastern Europe, near the Carpathian Mountains. In addition, the Northern clade presents an important substructure, suggesting two sequential colonization events in Europe. First, the continent was colonized from the three main refugial areas mentioned above during the Lower-Mid Pleistocene. Second, recolonization of most of Europe most likely originated from several refugia located outside of the Mediterranean peninsulas (Carpathian region, east of the Carpathians, France and possibly Hungary) during the Mid-Late Pleistocene, while populations within the Italian and Balkan Peninsulas fluctuated only slightly in distribution range, with larger lowland populations during glacial times and with refugial mountain populations during interglacials, as in the present time. The phylogeographical structure revealed in our study suggests complex recolonization dynamics of the European continent by V. berus, characterized by latitudinal as well as altitudinal range shifts, driven by both climatic changes and competition with related species.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Current directions in DNA gel particles

A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.

Genetic structure and gene flow of Eugenia dysenterica natural populations

This study was carried out to assess the genetic variability of ten "cagaita" tree (Eugenia dysenterica) populations in Southeastern Goiás. Fifty-four randomly amplified polymorphic DNA (RAPD) loci were used to characterize the population genetic variability, using the analysis of molecular variance (AMOVA). A phiST value of 0.2703 was obtained, showing that 27.03% and 72.97% of the genetic variability is present among and within populations, respectively. The Pearson correlation coefficient (r) among the genetic distances matrix (1 - Jaccard similarity index) and the geographic distances were estimated, and a strong positive correlation was detected. Results suggest that these populations are differentiating through a stochastic process, with restricted and geographic distribution dependent gene flow.

Structure-function analysis of the human TFIIB-related factor II protein reveals an essential role for the C-terminal domain in RNA polymerase III transcription.

The transcription factors TFIIB, Brf1, and Brf2 share related N-terminal zinc ribbon and core domains. TFIIB bridges RNA polymerase II (Pol II) with the promoter-bound preinitiation complex, whereas Brf1 and Brf2 are involved, as part of activities also containing TBP and Bdp1 and referred to here as Brf1-TFIIIB and Brf2-TFIIIB, in the recruitment of Pol III. Brf1-TFIIIB recruits Pol III to type 1 and 2 promoters and Brf2-TFIIIB to type 3 promoters such as the human U6 promoter. Brf1 and Brf2 both have a C-terminal extension absent in TFIIB, but their C-terminal extensions are unrelated. In yeast Brf1, the C-terminal extension interacts with the TBP/TATA box complex and contributes to the recruitment of Bdp1. Here we have tested truncated Brf2, as well as Brf2/TFIIB chimeric proteins for U6 transcription and for assembly of U6 preinitiation complexes. Our results characterize functions of various human Brf2 domains and reveal that the C-terminal domain is required for efficient association of the protein with U6 promoter-bound TBP and SNAP(c), a type 3 promoter-specific transcription factor, and for efficient recruitment of Bdp1. This in turn suggests that the C-terminal extensions in Brf1 and Brf2 are crucial to specific recruitment of Pol III over Pol II.