Increased expression of preprotachykinin-I and neurokinin receptors in human breast cancer cells: Implications for bone marrow metastasis

Neuropeptides are implicated in many tumors, breast cancer (BC) included. Preprotachykinin-I (PPT-I) encodes multiple neuropeptides with pleiotropic functions such as neurotransmission, immune/hematopoietic modulation, angiogenesis, and mitogenesis. PPT-I is constitutively expressed in some tumors. In this study, we investigated a role for PPT-I and its receptors, neurokinin-1 (NK-1) and NK-2, in BC by using quantitative reverse transcription–PCR, ELISA, and in situ hybridization. Compared with normal mammary epithelial cells (n = 2) and benign breast biopsies (n = 21), BC cell lines (n = 7) and malignant breast biopsies (n = 25) showed increased expression of PPT-I and NK-1. NK-2 levels were high in normal and malignant cells. Specific NK-1 and NK-2 antagonists inhibited BC cell proliferation, suggesting autocrine and/or intercrine stimulation of BC cells by PPT-I peptides. NK-2 showed no effect on the proliferation of normal cells but mediated the proliferation of BC cells. Cytosolic extracts from malignant BC cells enhanced PPT-I translation whereas extracts from normal mammary epithelial cells caused no change. These enhancing effects may be protein-specific because a similar increase was observed for IL-6 translation and no effect was observed for IL-1α and stem cell factor. The data suggest that PPT-I peptides and their receptors may be important in BC development. Considering that PPT-I peptides are hematopoietic modulators, these results could be extended to understand early integration of BC cells in the bone marrow, a preferred site of metastasis. Molecular signaling transduced by PPT-I peptides and the mechanism that enhances translation of PPT-I mRNA could lead to innovative strategies for BC treatments and metastasis.

Microglial activation precedes acute neurodegeneration in Sandhoff disease and is suppressed by bone marrow transplantation

Sandhoff disease is a lysosomal storage disorder characterized by the absence of β-hexosaminidase and storage of GM2 ganglioside and related glycolipids in the central nervous system. The glycolipid storage causes severe neurodegeneration through a poorly understood pathogenic mechanism. In symptomatic Sandhoff disease mice, apoptotic neuronal cell death was prominent in the caudal regions of the brain. cDNA microarray analysis to monitor gene expression during neuronal cell death revealed an upregulation of genes related to an inflammatory process dominated by activated microglia. Activated microglial expansion, based on gene expression and histologic analysis, was found to precede massive neuronal death. Extensive microglia activation also was detected in a human case of Sandhoff disease. Bone marrow transplantation of Sandhoff disease mice suppressed both the explosive expansion of activated microglia and the neuronal cell death without detectable decreases in neuronal GM2 ganglioside storage. These results suggest a mechanism of neurodegeneration that includes a vigorous inflammatory response as an important component. Thus, this lysosomal storage disease has parallels to other neurodegenerative disorders, such as Alzheimer's and prion diseases, where inflammatory processes are believed to participate directly in neuronal cell death.

Clonable progenitors committed to the T lymphocyte lineage in the mouse bone marrow; use of an extrathymic pathway

We searched for clonable committed T cell progenitors in the adult mouse bone marrow and isolated rare (≈0.05%) cells with the Thy-1hiCD2−CD16+CD44hiCD25−Lin− phenotype. In vivo experiments showed that these cells were progenitors committed only to reconstituting the T cell lineage of irradiated Ly5 congenic hosts. Reconstitution of the thymus was minimal compared with that of the bone marrow, spleen, and lymph nodes. At limiting dilutions, donor T cell reconstitution of the spleen frequently occurred without detectable donor cells in the thymus. Progenitors were capable of rapidly reconstituting athymic hosts. In conclusion, the clonable bone marrow progenitors were capable of T cell reconstitution predominantly by means of an extrathymic pathway.

Human blood-mobilized hematopoietic precursors differentiate into osteoclasts in the absence of stromal cells.

Osteoclastogenesis is a complex process that is facilitated by bone marrow stromal cells (SCs). To determine if SCs are an absolute requirement for the differentiation of human hematopoietic precursors into fully mature, osteoclasts (OCs), CD34+ cells were mobilized into the peripheral circulation with granulocyte colony-stimulating factor, harvested by leukapheresis, and purified by magnetic-activated cell sorting. This procedure yields a population of CD34+ cells that does not contain SC precursors, as assessed by the lack of expression of the SC antigen Stro-1, and that differentiates only into hematopoietic cells. We found that CD34+, Stro-1- cells cultured with a combination of granulocyte/macrophage colony-stimulating factor, interleukin 1, and interleukin 3 generated cells that fulfill current criteria for the characterization of OCs, including multinucleation, presence of tartrate-resistant acid phosphatase, and expression of the calcitonin and vitronectin receptors and of pp60c-src tyrosine kinase. These OCs also expressed mRNA for the noninserted isoform of the calcitonin receptor and excavated characteristic resorption pits in devitalized bone slices. These data demonstrate that accessory SCs are not essential for human osteoclastogenesis and that granulocyte colony-stimulating factor treatment mobilizes OC precursors into the peripheral circulation.

The stem cell antigen CD34 functions as a regulator of hemopoietic cell adhesion.

Although the CD34 antigen is widely used in the identification and purification of hemopoietic stem and progenitor cells, its function within hemopoiesis is unknown. We have investigated this issue by ectopically expressing human (hu) CD34 on the surface of murine hemopoietic cells. Forced expression of hu-CD34 in the thymocytes of transgenic mice did not appear to affect the development, maturation, or distribution of murine T cells but did significantly increase their ability to adhere to bone marrow stromal layers of human but not mouse origin. Ectopic expression of hu-CD34 on murine 416B cells, a multipotential progenitor that expresses murine CD34, yielded similar results. In both cases hu-CD34-dependent adhesion was enhanced by molecular engagement of the hu-CD34 protein using anti-CD34 antibodies. These results provide evidence that CD34 promotes the adhesive interactions of hemopoietic cells with the stromal microenvironment of the bone marrow thereby implicating CD34 in regulation and compartmentalization of stem cells. We propose that CD34 regulates these processes in part via an indirect mechanism, signaling changes in cellular adhesion in response to molecular recognition of an as yet unidentified stromal CD34 counterreceptor or ligand.

A recombinant bcl-x s adenovirus selectively induces apoptosis in cancer cells but not in normal bone marrow cells.

Many cancers overexpress a member of the bcl-2 family of inhibitors of apoptosis. To determine the role of these proteins in maintaining cancer cell viability, an adenovirus vector that expresses bcl-xs, a functional inhibitor of these proteins, was constructed. Even in the absence of an exogenous apoptotic signal such as x-irradiation, this virus specifically and efficiently kills carcinoma cells arising from multiple organs including breast, colon, stomach, and neuroblasts. In contrast, normal hematopoietic progenitor cells and primitive cells capable of repopulating severe combined immunodeficient mice were refractory to killing by the bcl-xs adenovirus. These results suggest that Bcl-2 family members are required for survival of cancer cells derived from solid tissues. The bcl-xs adenovirus vector may prove useful in killing cancer cells contaminating the bone marrow of patients undergoing autologous bone marrow transplantation.

Processing and cryopreservation of placental/umbilical cord blood for unrelated bone marrow reconstitution.

Clinical evidence of hematopoietic restoration with placental/umbilical cord blood (PCB) grafts indicates that PCB can be a useful source of hematopoietic stem cells for routine bone marrow reconstitution. In the unrelated setting, human leukocyte antigen (HLA)-matched donors must be obtained for candidate patients and, hence, large panels of frozen HLA-typed PCB units must be established. The large volume of unprocessed units, consisting mostly of red blood cells, plasma, and cryopreservation medium, poses a serious difficulty in this effort because storage space in liquid nitrogen is limited and costly. We report here that almost all the hematopoietic colony-forming cells present in PCB units can be recovered in a uniform volume of 20 ml by using rouleaux formation induced by hydroxyethyl starch and centrifugation to reduce the bulk of erythrocytes and plasma and, thus, concentrate leukocytes. This method multiples the number of units that can be stored in the same freezer space as much as 10-fold depending on the format of the storage system. We have also investigated the proportion of functional stem/progenitor cells initially present that are actually available to the recipient when thawed cryopreserved PCB units are infused. Progenitor cell viability is measurably decreased when thawed cells, still suspended in hypertonic cryopreservative solutions, are rapidly mixed with large volumes of isotonic solutions or plasma. The osmotic damage inflicted by the severe solute concentration gradient, however, can be averted by a simple 2-fold dilution after thawing, providing almost total recovery of viable hematopoietic progenitor cells.

The VLA4/VCAM-1 adhesion pathway defines contrasting mechanisms of lodgement of transplanted murine hemopoietic progenitors between bone marrow and spleen.

Selective lodgement or homing of transplanted hemopoietic stem cells in the recipient's bone marrow (BM) is a critical step in the establishment of long-term hemopoiesis after BM transplantation. However, despite its biologic and clinical significance, little is understood about the process of homing. In the present study, we have concentrated on the initial stages of homing and explored the functional role in vivo of some of the adhesion pathways previously found to mediate in vitro adhesion of hemopoietic cells to cultured BM stroma. We have found that homing of murine hemopoietic progenitors of the BM of lethally irradiated recipients at 3 h after transplant was significantly reduced after pretreatment of the donor cells with an antibody to the integrin very late antigen 4 (VLA4). This inhibition of marrow homing was accompanied by an increase in hemopoietic progenitors circulating in the blood and an increased uptake of these progenitors by the spleen. Similar results were obtained by treatment of the recipients with an antibody to vascular cell adhesion molecule 1 (VCAM-1), a ligand for VLA4. Furthermore, we showed that administration of the same antibodies (anti-VLA4 or anti-VCAM-1) to normal animals causes mobilization of hemopoietic progenitors into blood. These data suggest that hemopoietic cell lodgement in the BM is a regulatable process and can be influenced by VLA4/VCAM-1 adhesion pathway. Although additional molecular pathways are not excluded and may be likely, our data establish VCAM-1 as a BM endothelial addressin, analogous to the role that mucosal addressin cell adhesion molecule (MAdCAM) plays in lymphocyte homing. Whether splenic uptake of hemopoietic progenitors is passive or controlled through different mechanisms remains to be clarified. In addition, we provide experimental evidence that homing and mobilization are related phenomena involving, at least partly, similar molecular pathways.

Modification of rhodamine staining allows identification of hematopoietic stem cells with preferential short-term or long-term bone marrow-repopulating ability.

We have developed a modified rhodamine (Rho) staining procedure to study uptake and efflux in murine hematopoietic stem cells. Distinct populations of Rho++ (bright), Rho+ (dull), and Rho- (negative) cells could be discriminated. Sorted Rho- cells were subjected to a second Rho staining procedure with the P-glycoprotein blocking agent verapamil (VP). Most cells became Rho positive [Rho-/Rho(VP)+ cells] and some remained Rho negative [Rho-/Rho(VP)- cells]. These cell fractions were characterized by their marrow-repopulating ability in a syngeneic, sex-mismatch transplantation model. Short-term repopulating ability was determined by recipient survival for at least 6 weeks after lethal irradiation and transplantation--i.e., radioprotection. Long-term repopulating ability at 6 months after transplantation was measured by fluorescence in situ hybridization with a Y-chromosome-specific probe, by graft function and recipient survival. Marrow-repopulating cells were mainly present in the small Rho- cell fraction. Transplantation of 30 Rho- cells resulted in 50% radioprotection and > 80% donor repopulation in marrow, spleen, and thymus 6 months after transplantation. Cotransplantation of cells from both fractions in individual mice directly showed that within this Rho- cell fraction, the Rho-/Rho(VP)+ cells exhibited mainly short-term and the Rho-/Rho(VP)- cells exhibited mainly long-term repopulating ability. Our results indicate that hematopoietic stem cells have relatively high P-glycoprotein expression and that the cells responsible for long-term repopulating ability can be separated from cells exhibiting short-term repopulating ability, probably by a reduced mitochondrial Rho-binding capacity.

Effects of retroviral vector design on expression of human adenosine deaminase in murine bone marrow transplant recipients engrafted with genetically modified cells.

To determine which features of retroviral vector design most critically affect gene expression in hematopoietic cells in vivo, we have constructed a variety of different retroviral vectors which encode the same gene product, human adenosine deaminase (EC 3.5.4.4), and possess the same vector backbone yet differ specifically in transcriptional control sequences suggested by others to be important for gene expression in vivo. Murine bone marrow cells were transduced by each of the recombinant viruses and subsequently used to reconstitute the hematopoietic system of lethally irradiated recipients. Five to seven months after transplantation, analysis of the peripheral blood of animals transplanted with cells transduced by vectors which employ viral long terminal repeats (LTRs) for gene expression indicated that in 83% (77/93) of these animals, the level of human enzyme was equal to or greater than the level of endogenous murine enzyme. Even in bone marrow transplant recipients reconstituted for over 1 year, significant levels of gene expression were observed for each of the vectors in their bone marrow, spleen, macrophages, and B and T lymphocytes. However, derivatives of the parental MFG-ADA vector which possess either a single base mutation (termed B2 mutation) or myeloproliferative sarcoma virus LTRs rather than the Moloney murine leukemia virus LTRs led to significantly improved gene expression in all lineages. These studies indicate that retroviral vectors which employ viral LTRs for the expression of inserted sequences make it possible to obtain high levels of a desired gene product in most hematopoietic cell lineages for close to the lifetime of bone marrow transplant recipients.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Nutritional status and energy expenditure in children pre-bone-marrow-transplant

The aims of this study were to establish the nutritional status of children pre- BMT and to determine whether predictive methods of assessing nutritional status and resting energy expenditure ( REE) are accurate in this population. We analysed the body cell mass ( BCM) ( n = 26) and REE ( n = 24) in children undergoing BMT. BCM was adjusted for height ( BCM/ HTp) and expressed as a Z score to represent nutritional status. To determine whether body mass index ( BMI) was indicative of nutritional status in children undergoing BMT, BMI Z scores were compared to the reference method of BCM/ HTp Z scores. Schofield predictive equations of basal metabolic rate ( BMR) were compared to measured REE to evaluate the accuracy of the predictive equations. The mean BCM/ HTp Z score for the subject population was -1.09 +/- 1.28. There was no significant relationship between BCM/ HTp Z score and BMI Z score ( r = 0.34; P > 0.05); however there was minimal difference between measured REE and predicted BMR ( bias = -11 +/- 149 kcal/ day). The results of this study demonstrate that children undergoing BMT may have suboptimal nutritional status and that BMI is not an accurate indication of nutritional status in this population. However, Schofield equations were found to be suitable for representing REE in children pre- BMT.

Host B cells produce IL-10 following TBI and attenuate acute GVHD after allogeneic bone marrow transplantation

Host antigen-presenting cells (APCs) are known to be critical for the induction of graft-versus-host disease (GVHD) after allogeneic bone marrow transplantation (BMT), but the relative contribution of specific APC subsets remains unclear. We have studied the role of host B cells in GVHD by using B-cell-deficient mu MT mice as BMT recipients in a model of CD4-dependent GVHD to major histocompatlibility complex antigens. We demonstrate that acute GVHD is initially augmented in mu MT recipients relative to wild-type recipients (mortality: 85% vs 44%, P < .01), and this is the result of an increase in donor T-cell proliferation, expansion, and inflammatory cytokine production early after BMT. Recipient B cells were depleted 28-fold at the time of BMT by total body irradiation (TBI) administered 24 hours earlier, and we demonstrate that TBI rapidly induces sustained interleukin-110 (IL-10) generation from B cells but not dendritic cells (DCs) or other cellular populations within the spleen. Finally, recipient mice in which B cells are unable to produce IL-10 due to homologous gene deletion develop more severe acute GVHD than recipient mice in which B cells are wild type. Thus, the induction of IL-10 in host B cells during conditioning attenuates experimental acute GVHD.

Bone marrow-derived mesenchymal stem cells become anti-angiogenic when chondrogenically or osteogenically differentiated:implications for bone and cartilage tissue engineering

Osteochondral tissue repair requires formation of vascularized bone and avascular cartilage. Mesenchymal stem cells stimulate angiogenesis both in vitro and in vivo but it is not known if these proangiogenic properties change as a result of chondrogenic or osteogenic differentiation. We investigated the angiogenic/antiangiogenic properties of equine bone marrow-derived mesenchymal stem cells (eBMSCs) before and after differentiation in vitro. Conditioned media from chondrogenic and osteogenic cell pellets and undifferentiated cells was applied to endothelial tube formation assays using Matrigel™. Additionally, the cell secretome was analysed using LC-MS/MS mass spectrometry and screened for angiogenesis and neurogenesis-related factors using protein arrays. Endothelial tube-like formation was supported by conditioned media from undifferentiated eBMSCs. Conversely, chondrogenic and osteogenic conditioned media was antiangiogenic as shown by significantly decreased length of endothelial tube-like structures and degree of branching compared to controls. Undifferentiated cells produced higher levels of angiogenesis-related proteins compared to chondrogenic and osteogenic pellets. In summary, eBMSCs produce an array of angiogenesis-related proteins and support angiogenesis in vitro via a paracrine mechanism. However, when these cells are differentiated chondrogenically or osteogenically, they produce a soluble factor(s) that inhibits angiogenesis. With respect to osteochondral tissue engineering, this may be beneficial for avascular articular cartilage formation but unfavourable for bone formation where a vascularized tissue is desired. © Copyright 2014, Mary Ann Liebert, Inc.

Regulation of Bone Marrow Stem Cells through Oscillatory Shear Stresses - A Heart Valve Tissue Engineering Perspective

Heart valve disease occurs in adults as well as in pediatric population due to age-related changes, rheumatic fever, infection or congenital condition. Current treatment options are limited to mechanical heart valve (MHV) or bio-prosthetic heart valve (BHV) replacements. Lifelong anti-coagulant medication in case of MHV and calcification, durability in case of BHV are major setbacks for both treatments. Lack of somatic growth of these implants require multiple surgical interventions in case of pediatric patients. Advent of stem cell research and regenerative therapy propose an alternative and potential tissue engineered heart valves (TEHV) treatment approach to treat this life threatening condition. TEHV has the potential to promote tissue growth by replacing and regenerating a functional native valve. Hemodynamics play a crucial role in heart valve tissue formation and sustained performance. The focus of this study was to understand the role of physiological shear stress and flexure effects on de novo HV tissue formation as well as resulting gene and protein expression. A bioreactor system was used to generate physiological shear stress and cyclic flexure. Human bone marrow mesenchymal stem cell derived tissue constructs were exposed to native valve-like physiological condition. Responses of these tissue constructs to the valve-relevant stress states along with gene and protein expression were investigated after 22 days of tissue culture. We conclude that the combination of steady flow and cyclic flexure helps support engineered tissue formation by the co-existence of both OSS and appreciable shear stress magnitudes, and potentially augment valvular gene and protein expression when both parameters are in the physiological range.