890 resultados para Barrier Coatings
Resumo:
Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.
Resumo:
Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.
Resumo:
Työn aiheena oli tutkia vaahdon soveltuvuutta ohuiden päällystyskerrosten applikointiin paperin tai kartongin pinnalle. Paperia ja kartonkia päällystetään teollisessa mittakaavassa eri menetelmillä, mutta niille kaikille yhteistä on päällystyspastan laimentaminen vedellä ennen applikointia ja laimennusveden haihduttaminen applikoinnin jälkeen päällysteen asettamiseksi. Laimennus on tärkeää pastan komponenttien tasaisen levittämisen vuoksi, mutta veden haihduttaminen kuluttaa valtavasti energiaa. Tekstiiliteollisuudessa on saavutettu merkittäviä säästöjä kuivausenergiassa korvaamalla laajalti vedellä laimentaminen vaahdottamisella. Diplomityön kirjallisessa osassa käytiin läpi vaahdon kemiallisia ja fysikaalisia ominaisuuksia sekä selvitettiin mitä kemikaaleja ja laitteita vaahdotukseen käytetään. Lisäksi luotiin katsaus vaahtoprosessien käyttöön tekstiiliteollisuudessa ja muilla aloilla. Kokeellinen osa koostui esikokeista, joissa selvitettiin pastan koostumuksen vaikutuksia vaahtoamiseen, ja pilot-mittakaavan koeajoista, joissa esikokeiden tuloksia hyödynnettiin. Esikokeissa huomiota kiinnitettiin varsinkin eri polyvinyylialkoholien (PVA) seosten erinomaiseen vaahtoavuuteen. Pilot-koeajoissa vaahtopäällystys vaikutti lupaavalta menetelmältä, joskaan täysin tyydyttävää päällystystulosta ei saavutettu. Suurimpana ongelmana esiintyi ilman pääseminen pohjapaperin ja päällysteen väliin ja siitä seuraava huono päällystejälki. Toisen ongelmakokonaisuuden muodostivat päällysteeseen jäävät reiät. Vaahtopäällystys vaikuttaa lupaavalta tekniikalta ohuiden päällystekerrosten applikointiin, mutta pastareseptejä tulee optimoida ja ratkaista päällysteen alle pääsevän ilman ongelma.
Resumo:
The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.
Resumo:
The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Jaboticaba is a Brazilian fruit, native to the Atlantic forest, which belongs to the Myrtaceae family. In this work we describe the effect of the thinning of "flower", "fruit" and "flower & fruit" compared to non-thinned fruit (control) and of edible coatings with respect on nutritional composition, overall acceptability and shelf-life of jaboticaba ‘Sabara’, grown in an irrigated commercial orchard. "Flower and fruit" thinning allows fruit with higher quality as diameter, volume and mass. Non-thinned fruit shows higher yield, however fruit have lower quality. As a result of the improving quality at harvest, the shelf life was twice (~8 days) for thinned fruit. The lack of change in concentration of soluble sugar and absence of formation of volatile compounds during storage indicate that there was no natural fermentation of the jaboticaba pulp after harvest. Treatments with wax and calcium did not improve the jaboticaba shelf life.
Resumo:
Abstract Fish consumption has increased in recent years. However, fish meat is highly perishable, which demonstrates the need for technologies to preserve its quality. Edible coatings (EC) might provide an alternative to extend the shelf life of fish. The goal of this study was to evaluate the effect of EC of chitosan (C) in combination with carvacrol (CAR) on the physical and microbiological changes of tilapia fillets. Fillets were submerged for two minutes in different treatments (T1: control; T2: C 2%; T3: C 2% + 0.125% CAR; T 4: C 2% + 0.25% CAR). At the end of storage, T1 and T2 showed the lowest values of total volatile bases (TVB). The color parameters L*, a* and b* varied from each treatment. The texture decreased and the different treatments reduced the microbial population in relation to the control; T3 and T4 were the most effective. These results show that the use of C with CAR might be an alternative method to preserve the quality and safety of tilapia fillets.
Resumo:
Comprend : Réflexions
Resumo:
La barrière hémato-encéphalique (BHE) protège le système nerveux central (SNC) en contrôlant le passage des substances sanguines et des cellules immunitaires. La BHE est formée de cellules endothéliales liées ensemble par des jonctions serrées et ses fonctions sont maintenues par des astrocytes, celles ci sécrétant un nombre de facteurs essentiels. Une analyse protéomique de radeaux lipidiques de cellules endothéliales de la BHE humaine a identifié la présence de la voie de signalisation Hedgehog (Hh), une voie souvent liées à des processus de développement embryologique ainsi qu’au niveau des tissus adultes. Suite à nos expériences, j’ai déterminé que les astrocytes produisent et secrètent le ligand Sonic Hh (Shh) et que les cellules endothéliales humaines en cultures primaires expriment le récepteur Patched (Ptch)-1, le co-récepteur Smoothened (Smo) et le facteur de transcription Gli-1. De plus, l’activation de la voie Hh augmente l’étanchéité des cellules endothéliales de la BHE in vitro. Le blocage de l’activation de la voie Hh en utilisant l’antagoniste cyclopamine ainsi qu’en utilisant des souris Shh déficientes (-/-) diminue l’expression des protéines de jonctions serrées, claudin-5, occcludin, et ZO-1. La voie de signalisation s’est aussi montrée comme étant immunomodulatoire, puisque l’activation de la voie dans les cellules endothéliales de la BHE diminue l’expression de surface des molécules d’adhésion ICAM-1 et VCAM-1, ainsi que la sécrétion des chimiokines pro-inflammatoires IL-8/CXCL8 et MCP-1/CCL2, créant une diminution de la migration des lymphocytes CD4+ à travers une monocouche de cellules endothéliales de la BHE. Des traitements avec des cytokines pro-inflammatoires TNF-α and IFN-γ in vitro, augmente la production de Shh par les astrocytes ainsi que l’expression de surface de Ptch-1 et de Smo. Dans des lésions actives de la sclérose en plaques (SEP), où la BHE est plus perméable, les astrocytes hypertrophiques augmentent leur expression de Shh. Par contre, les cellules endothéliales de la BHE n’augmentent pas leur expression de Ptch-1 ou Smo, suggérant une dysfonction dans la voie de signalisation Hh. Ces résultats montrent que la voie de signalisation Hh promeut les propriétés de la BHE, et qu’un environnement d’inflammation pourrait potentiellement dérégler la BHE en affectant la voie de signalisation Hh des cellules endothéliales.
Resumo:
In the present work Titania bulk powders and coatings were prepared by subjecting titanium isopropoxide solution to a controlled hydrolysis-condensation process. The powders were characterized using techniques such as FTIR for their chemical interactions, TG-DTA for the thermal decomposition features, XRD for the phase assemblage, BET specific surface area analysis for the textural features. The study discusses the preparation methods and the characterization techniques employed and a detailed discussion on the physico-chemical characterization of the prepared systems. The influence of dopants and leaching on the physico-chemical properties as well as their influence on photo activity is also included. The structural/functional coatings of different Titania compositions includes in this study. Coatings on pre-treated glass surfaces with the best compositions prepared showed 90 % transmittance in the visible region.
Resumo:
The fabrication and characterization of a fibre optic pH sensor based on evanescent wave absorption is presented. The unclad portion of a multi-mode optical fibre is coated with a pH sensitive dye, which is immobilized by the sol–gel route. The sensitivity of the device has been found to increase when multiple sol–gel coatings are used as the sensing region. The dynamic range and the temporal response of the sensor are investigated for two different dyes, namely bromocresol purple and bromocresol green. The performance of the device is evaluated in terms of the results obtained during actual measurements.