927 resultados para mRNA export


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Estradiol participates in the control of energy homeostasis, as demonstrated by an increase in food intake and in body weight gain after ovariectomy in rats. In the present study, female Wistar rats (200-230 g, N = 5-15 per group), with free access to chow, were individually housed in metabolic cages. We investigated food intake, body weight, plasma leptin levels, measured by specific radioimmunoassay, and the hypothalamic mRNA expression of orexigenic and anorexigenic neuropeptides, determined by real-time PCR, in ovariectomized rats with (OVX+E) and without (OVX) estradiol cypionate treatment (10 µg/kg body weight, sc, for 8 days). Hormonal and mRNA expression were determined at pre-feeding and 4 h after food intake. OVX+E rats showed lower food intake, less body weight gain and lower plasma leptin levels. In the OVX+E group, we also observed a reduction of neuropeptide Y (NPY), agouti-related protein (AgRP) and cocaine- and amphetamine-regulated transcript (CART) mRNA expression in the arcuate nucleus and a decrease in orexin A in the lateral hypothalamic area (LHA). There was an increase in leptin receptor (LepRb), melanocortin-4 receptor (MC4-R), CART, and mainly corticotropin-releasing hormone (CRH) mRNA in the paraventricular nucleus and LepRb and CART mRNA in the LHA. These data show that hypophagia induced by estradiol treatment is associated with reduced hypothalamic expression of orexigenic peptides such as NPY, AgRP and orexin A, and increased expression of the anorexigenic mediators MC4-R, LepRb and CRH. In conclusion, estradiol decreases food intake, and this effect seems to be mediated by peripheral factors such as leptin and the differential mRNA expression of neuropeptides in the hypothalamus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

HTLV-1 Tax expression exerts an inhibitory effect on the Foxp3 transcription factor in CD4+CD25+ T-regulatory cells (Treg). For a better understanding of the role of Tax mRNA in the gene expression of cellular markers we measured Tax, Foxp3, CTLA-4, GITR, TGF-β, and IL-10 mRNA in Treg cells of 50 patients with human T-lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP; 27 women and 23 men; mean age: 56.7 years). The control group consisted of 23 non-infected subjects (12 women and 11 men) with a mean age of 51.3 years. Real-time PCR was used to measure mRNA of Tax proteins and several cellular markers of Treg function. Determinations revealed a high level of Tax mRNA in HAM/TSP (124.35 copies/100 CD4+CD25+ T cells). Foxp3, GITR, and CTLA-4 mRNA levels were lower in HAM/TSP patients (mean ± SD, 22.07 ± 0.78, 9.63 ± 0.36, and 4.54 ± 0.39, respectively) than in non-infected controls (47.15 ± 12.94, 22.14 ± 1.91, and 21.07 ± 2.31). Both groups had similar levels of TGF-β and IL-10. An inverse relationship was found between Tax levels and Foxp3, CTLA-4, and GITR levels. Conversely, there was a direct correlation between levels of Foxp3, GITR, and CTLA-4. Disease severity and evolution time did not correlate with Tax or Foxp3 levels. The present results suggest that Tax and Foxp3 mRNA vary with the same degree of disease severity in HAM/TSP patients. Tax fluctuations may affect CTLA-4 and GITR expression via the Foxp3 pathway, causing virus-induced dysfunction of CD4+CD25+ T cells in HAM/TSP patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The actions of thyroid hormone (TH) on pancreatic beta cells have not been thoroughly explored, with current knowledge being limited to the modulation of insulin secretion in response to glucose, and beta cell viability by regulation of pro-mitotic and pro-apoptotic factors. Therefore, the effects of TH on proinsulin gene expression are not known. This led us to measure: a) proinsulin mRNA expression, b) proinsulin transcripts and eEF1A protein binding to the actin cytoskeleton, c) actin cytoskeleton arrangement, and d) proinsulin mRNA poly(A) tail length modulation in INS-1E cells cultured in different media containing: i) normal fetal bovine serum - FBS (control); ii) normal FBS plus 1 µM or 10 nM T3, for 12 h, and iii) FBS depleted of TH for 24 h (Tx). A decrease in proinsulin mRNA content and attachment to the cytoskeleton were observed in hypothyroid (Tx) beta cells. The amount of eEF1A protein anchored to the cytoskeleton was also reduced in hypothyroidism, and it is worth mentioning that eEF1A is essential to attach transcripts to the cytoskeleton, which might modulate their stability and rate of translation. Proinsulin poly(A) tail length and cytoskeleton arrangement remained unchanged in hypothyroidism. T3 treatment of control cells for 12 h did not induce any changes in the parameters studied. The data indicate that TH is important for proinsulin mRNA expression and translation, since its total amount and attachment to the cytoskeleton are decreased in hypothyroid beta cells, providing evidence that effects of TH on carbohydrate metabolism also include the control of proinsulin gene expression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effect of leptin on the progression of colorectal carcinoma to metastatic disease by analyzing the serum leptin concentration and Ob-R gene expression in colon cancer tissues. Tissue samples were obtained from 31 patients who underwent surgical resection for colon (18 cases) and metastatic colon (13 cases) cancer. Serum leptin concentration was determined by an enzyme-linked immunosorbent assay (ELISA) and Ob-R mRNA expression by real-time polymerase chain reaction (RT-PCR) for both groups. ELISA data were analyzed by the Student t-test and RT-PCR data were analyzed by the Mann-Whitney U-test. RT-PCR results demonstrated that mRNA expression of Ob-R in human metastatic colorectal cancer was higher than in local colorectal cancer tissues. On the other hand, mean serum leptin concentration was significantly higher in local colorectal cancer patients compared to patients with metastatic colorectal cancer. The results of the present study suggest a role for leptin in the progression of colon cancer to metastatic disease without weight loss. In other words, significantly increased Ob-R mRNA expression and decreased serum leptin concentration in patients with metastatic colon cancer indicate that sensitization to leptin activity may be a major indicator of metastasis to the colon tissue and the determination of leptin concentration and leptin gene expression may be used to aid the diagnosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (rs=0.283, P=0.049) and serum albumin (rs=0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; rs=-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In DNA vaccines, the gene of interest is cloned into a bacterial plasmid that is engineered to induce protein production for long periods in eukaryotic cells. Previous research has shown that the intramuscular immunization of BALB/c mice with a naked plasmid DNA fragment encoding the Mycobacterium leprae 65-kDa heat-shock protein (pcDNA3-Hsp65) induces protection against M. tuberculosis challenge. A key stage in the protective immune response after immunization is the generation of memory T cells. Previously, we have shown that B cells capture plasmid DNA-Hsp65 and thereby modulate the formation of CD8+ memory T cells after M. tuberculosis challenge in mice. Therefore, clarifying how B cells act as part of the protective immune response after DNA immunization is important for the development of more-effective vaccines. The aim of this study was to investigate the mechanisms by which B cells modulate memory T cells after DNA-Hsp65 immunization. C57BL/6 and BKO mice were injected three times, at 15-day intervals, with 100 µg naked pcDNA-Hsp65 per mouse. Thirty days after immunization, the percentages of effector memory T (TEM) cells (CD4+ and CD8+/CD44high/CD62Llow) and memory CD8+ T cells (CD8+/CD44high/CD62Llow/CD127+) were measured with flow cytometry. Interferon γ, interleukin 12 (IL-12), and IL-10 mRNAs were also quantified in whole spleen cells and purified B cells (CD43−) with real-time qPCR. Our data suggest that a B-cell subpopulation expressing IL-10 downregulated proinflammatory cytokine expression in the spleen, increasing the survival of CD4+ TEM cells and CD8+ TEM/CD127+ cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Using a simple Cournot duopoly model, this paper provides an important policy implication for trade disputes involving export subsidies. In this paper, the possibility that a foreign export subsidy could benefit the domestic country as well as the foreign country by appropriately using countervailing duties is identified.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this study is to investigate the challenges of the adaptation process of education export. The research is conducted as a single case study that concentrates on three education export projects. The case company in the research is Team Academy. The study goes through the different forms of education export, the adaptation of education export and the challenges of the education export –process by means of theory and empirical data. The research is carried out as a qualitative research and the method used is a qualitative content analysis. More specifically the research is an abductive content analysis. The research data is collected in four in-depth interviews from Team academy representatives who have been strongly involved in certain education export –project of Team Academy. The research confirms the theory in the challenge of hierarchy, funding and registration issues, and refutes it in the challenge of competition, legislation, different governmental attitudes and knowledge in productization. The main challenges of the adaptation process are related to funding, differences in values, sudden changes, the complex nature of the learning model, concept of time, teamwork as method and accreditation. It is highlighted that in the future operations, anticipating problems that arise from for example cultural differences and differences in values, communication, managing the money flows and the company form is recommended. Future research could continue with investigating the suitable company form for education exports of this kind, and how to stand out and communicate when operating under another institution. It is considered a potential risk that a brand encloses the brand that operates under it.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of the public export promotion in Finland needed more research. The part of the public sector export promotion in the overall export is significant. In an ever more global world not only the companies but also the counties compete against each other and the governments have an interest to boost their economy as much as they are able to. Every industrialized country has export promotion services in some form or another. In the 21st century the tendency has been the bundling of the services and this has also been done in Finland with Team Finland. The role and the efficiency of the services provided deserve more research. The research question of this study is: What is the role of the public export promotion services in Finland? The question is researched primary by expert interviews conducted for this study. The situation in Southwest Finland is studied from the viewpoint of the companies of the region by conducting a survey aimed to the successfully internationalized companies of the region and asking them on their views on the impact and role of public export services in their internationalization. The theory base is formed out of various export promotion studies, studies monitoring the effects of the promotion and theories of the internationalization process of companies. The primary material for the study are the three expert interviews conducted and the answers to the survey conducted. The research method in the first part is a constructive qualitative research. The research approach in the second part, where the views of the companies in Southwest Finland are studied, is quantitative. The study findings from the expert interviews: the aligning of the public export promotion done in Finland to the previous research and the addition of the role of the public sector in classical frameworks. The study findings from the survey: the utilizing of the public export promotion services is heavily delayed and the internationalizing companies start to utilize the services very late in their internationalization process, the average being 10,3 years from the beginning of the internationalization. Another central finding from the survey is that the successfully internationalized companies see the public export promotion services generally as highly beneficial but in the light of the answers the effect on their own company is not as significant. Concluding can be stated that the public export promotion is seen as beneficial, but the monitoring of the efficiency is complicated in the case of services. Getting the companies to start utilizing the services earlier in their internationalization needs attention from the service providers. By communicating the achieved results and benefits better to the potential users of the services the internationalization process of the companies could be accelerated

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Low levels of ionizing radiation induce two translocation responses in soybean: a reduction in photoassimilate export from leaves and a change in the distribution pattern of exported photoassimilate within the plant. In this investigation these responses have been further studied specifically to ascertain the site of radiation damage and to better understand the physiological responses observed. Experimentally the primary data was obtained from studies in which a mature trifoliate leaf of a young soybean plant (Glycine ~ L. cultivar Harosoy '63) is isolated in a closed transparent chamber and allowed to photoassimilate 14C02 for 15 minutes. This is followed by an additional 45 ~_il'1;ute period before the plant is sectl.o ne d an d 14 C-ra dl' oactl.v.l ty d eterml. ne d'l n a 11 parts. Such 14c data provides one with the magnitude and distribution pattern of translocation. Further analyses were conducted to determine the relative levels of the major photosynthetic products using the techniques of paper chromatography and autoradiography. Since differences between control and irradiated P 1 ants were not 0 b serve d l' n t h e par tl't"lo nlng 0 f 14 C between the 80% ethanol-soluble and -insoluble fractions 14 or in the relative amounts of C-products of photosynthesis, the reduction in export in irradiated plants is not likely due to reduced availability of translocatable materials. Data presented in this thesis shows that photoassimilate export was not affected by gamma radiation until a threshold dose between 2.0 and 3.0 krads was reached. It was also observed that radiation-induced damage to the export process was capable of recovery in a period of 1 to 2 hours provided high light intensity was supplied. In contrast, the distribution pattern was shown to be extremely radiosensitive with a low threshold dose between .25 and .49 krads. Although this process was also capable of recovery,lt" occurred much earlier and was followed by a secondary effect which lasted at least for the duration of the experiments. The data presented in this thesis is interpreted to suggest that the sites of radiation action for the two translocation responses are different. In regards to photoassimilate export, the site of action of ionizing radiation is the leaf, quite possibly the process of photophosphorylation which may provide energy directly for phloem loading and for membrane integrity of the phloem tissue* In regards to the pattern of distribution of exported photoassimilate, the site is likely the apical sink, possibly the result of changes of levels of endogenous hormones. By the selection of radiation exposure dose and time post-irradiation, it is possible to affect independently these two processes suggesting that each may be regulated independent of the other and involves a distinct site.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Most human genes undergo alternative splicing and loss of splicing fidelity is associated with disease. Epigenetic silencing of hMLH 1 via promoter cytosine methylation is causally linked to a subset of sporadic non-polyposis colon cancer and is reversible by 5-aza-2' -deoxycytidine treatment. Here I investigated changes in hMLHI mRNA splicing profiles in normal fibroblasts and colon cancer-derived human cell lines. I established the types and frequencies of hMLHI mRNA transcripts generated under baseline conditions, after hydrogen peroxide induced oxidative stress, and in acutely 5-aza-2' -deoxycytidine-treated and stably derepressed cancer cell lines. I found that hMLHI is extensively spliced under all conditions including baseline (50% splice variants), the splice variant distribution changes in response to oxidative stress, and certain splice variants are sensitive to 5- aza-2' -deoxycytidine treatment: Splice variant diversity and frequency of exon 17 skipping correlates with the level of hMLHI promoter methylation suggesting a link between promoter methylation and mRNA splicing.