994 resultados para injection site pruritus


Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND AND OBJECTIVE: To compare the analgesic effectiveness and aesthetic appearance associated with topical, subconjunctival, and peribulbar anesthesia for intravitreal bevacizumab injection. PATIENTS AND METHODS: Sixty consecutive patients undergoing their first intravitreal bevacizumab injection were randomized to receive one of three forms of anesthesia: proxymetacaine eye drops, subconjunctival injection of 2% xylocaine, and peribulbar injection of 2% xylocaine. Pain associated with the intravitreal injection and with the entire procedure (including anesthesia administration) was recorded using a Visual Analog Scale 15 minutes after intravitreal injection. Anterior segment evaluation was performed 24 hours after injection to measure the number of clock hours of subconjunctival hemorrhage. RESULTS: Median injection-related pain score was significantly lower in the peribulbar group compared with the topical and subconjunctival groups (P < .05). Median entire procedure pain score was significantly higher In the peribulbar group compared with the topical and subconjunctival groups (P < .05). The median extent of subconjunctival hemorrhage was significantly lower in the topical group compared with the other groups (P < .05). CONCLUSION: Among the three anesthetic techniques, peribulbar anesthesia was associated with greater effectiveness in controlling injection-related pain but was least effective in controlling entire procedure pain. There was no significant difference in pain scores between the topical and subconjunctival groups, and topical anesthesia was associated with less subconjunctival hemorrhage.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Because CD4(+) T cells play a key role in aiding cellular immune responses, we wanted to assess whether increasing numbers of gene-engineered antigen-restricted CD4(+) T cells could enhance an antitumor response mediated by similarly gene-engineered CD8(+) T cells. In this study, we have used retroviral transduction to generate erbB2-reactive mouse T-cell populations composed of various proportions of CD4(+) and CD8(+) cells and then determined the antitumor reactivity of these mixtures. Gene-modified CD4(+) and CD8(+) T cells were shown to specifically secrete Tc1 (T cytotoxic-1) or Tc2 cytokines, proliferate, and lyse erbB2(+) tumor targets following antigen ligation in vitro. In adoptive transfer experiments using severe combined immunodeficient (scid) mice, we demonstrated that injection of equivalent numbers of antigen-specific engineered CD8(+) and CD4(+) T cells led to significant improvement in survival of mice bearing established lung metastases compared with transfer of unfractionated (largely CD8(+)) engineered T cells. Transferred CD4(+) T cells had to be antigen-specific (not just activated) and secrete interferon gamma (IFN-gamma) to potentiate the antitumor effect. Importantly, antitumor responses in these mice correlated with localization and persistence of gene-engineered T cells at the tumor site. Strikingly, mice that survived primary tumor challenge could reject a subsequent re-challenge. Overall, this study has highlighted the therapeutic potential of using combined transfer of antigen-specific gene-modified CD8(+) and CD4(+) T cells to significantly enhance T-cell adoptive transfer strategies for cancer therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although a new protocol of dobutamine stress echocardiography with the early injection of atropine (EA-DSE) has been demonstrated to be useful in reducing adverse effects and increasing the number of effective tests and to have similar accuracy for detecting coronary artery disease (CAD) compared with conventional protocols, no data exist regarding its ability to predict long-term events. The aim of this study was to determine the prognostic value of EA-DSE and the effects of the long-term use of beta blockers on it. A retrospective evaluation of 844 patients who underwent EA-DSE for known or suspected CAD was performed; 309 (37%) were receiving beta blockers. During a median follow-up period of 24 months, 102 events (12%) occurred. On univariate analysis, predictors of events were the ejection fraction (p <0.001), male gender (p <0.001), previous myocardial infarction (p <0.001), angiotensin-converting enzyme inhibitor therapy (p = 0.021), calcium channel blocker therapy (p = 0.034), and abnormal results on EA-DSE (p <0.001). On multivariate analysis, the independent predictors of events were male gender (relative risk [RR] 1.78, 95% confidence interval [CI] 1.13 to 2.81, p = 0.013) and abnormal results on EA-DSE (RR 4.45, 95% CI 2.84 to 7.01, p <0.0001). Normal results on EA-DSE with P blockers were associated with a nonsignificant higher incidence of events than normal results on EA-DSE without beta blockers (RR 1.29, 95% CI 0.58 to 2.87, p = 0.54). Abnormal results on EA-DSE with beta blockers had an RR of 4.97 (95% CI 2.79 to 8.87, p <0.001) compared with normal results, while abnormal results on EA-DSE without beta blockers had an RR of 5.96 (95% CI 3.41 to 10.44, p <0.001) for events, with no difference between groups (p = 0.36). In conclusion, the detection of fixed or inducible wall motion abnormalities during EA-DSE was an independent predictor of long-term events in patients with known or suspected CAD. The prognostic value of EA-DSE was not affected by the long-term use of beta blockers. (C) 2008 Elsevier Inc. All rights reserved. (Am J Cardiol 2008;102:1291-1295)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aims: We evaluated the effect of botulinum toxin type A (BTX-A) injections in the trigone on the antireflux mechanism and evaluated its short-term efficacy. Materials and Methods: Between April and December 2006, 21 patients (10 men and 11 women) were prospectively evaluated. All were incontinent due to refractory NDO and underwent detrusor injection of 300 units of BTX-A, including 50 units into the trigone. Baseline and postoperative evaluation after eight weeks included cystogram, urinary tract ultrasound and urodynamics. Results: At baseline, 20 patients had no vesicoureteral (VUR) and one had grade II unilateral VUR. Postoperative evaluation revealed no cases of de novo VUR and the patient with preinjection VUR had complete resolution of the reflux. Ultrasound showed 5 (23.8%) patients with hydronephrosis before BTX-A injection and only one (4.8%) at the followup evaluation (p=0.066). After treatment, 9 (42.8%) patients became dry, 11 (52.4%) were improved and one (4.8%) had no improvement. Improved patients received antimuscarinic treatment and 8 (38.1%) became dry, with a final total continence rate of 80.1%. Cystometric capacity increased from 271 +/- 92 to 390 +/- 1189 ml (p = 0.002), reflex volume varied from 241 +/- 96 to 323 +/- 201 ml (p = 0.020) and maximum detrusor pressure reduced from 66 +/- 39 to 38 +/- 37 cm H2O (p < 0.001). Conclusions: Our results confirm the safety of trigone injections of BTX-A in terms of development of VUR and upper urinary tract damage. Whether they are beneficial for patients with NDO or other causes of voiding dysfunction will need further studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effect of intra-bone injection of differentiated rat bone marrow mesenchymal stem cells (BMMSCs) into the femur of osteoporotic female rats was studied. Osteoporosis was induced in Wistar female rats by bilateral ovariectomy. Then, 0.75 million BMMSCs isolated from healthy rats were injected into the femurs of osteoporotic rats. Histomorphometric analysis and histology clearly revealed improvements in the treated group as compared to untreated group. In 2 months, the femurs of treated rats, unlike untreated rats, showed trabecular bone percentage almost similar to the femurs from control healthy rats. To confirm the origin of newly formed bone, the experiment was repeated with BMMSCs isolated from green fluorescent protein transgenic rats. Confocal microscopy demonstrated green fluorescent protein-positive cells at the surface of trabecular bone of the treated rats. We investigated in vitro osteogenic differentiation of BMMSCs isolated from osteoporotic rats by studying alkaline phosphatase activity, collagen synthesis, and the ability to form mineralized nodules. Osteoporotic BMMSCs showed less differentiation capabilities as compared to those isolated from healthy rats. The results clearly demonstrated the importance of BMMSCs in osteoporosis and that the disease can be treated by injection of BMMSCs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A sample of 312 heroin users was interviewed on their injection of methadone syrup. Methadone injecting was widespread, with 52% of subjects having injected methadone syrup, 29% in the preceding six months. Males and females were equally likely to report methadone injecting. Forty per cent Of current methadone injectors reported weekly or more frequent methadone injecting over the preceding six months. A history of methadone injecting was;associated with abscesses and infections in injection sites, having been diagnosed with a venous thrombosis and a history of heroin overdose. Current methadone injectors were in poorer general health, had more injection-related symptoms, higher levels of psychological distress, were more likely to have recently passed on used injecting equipment and to have recently committed criminal acts. Implications for the reduction in the prevalence of methadone injecting and associated harm are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction and objectives: Recurrent transplant pyelonephritis (RTP) secondary to vesico-ureteral reflux (VUR) to the transplant kidney (KTx) remains a significant cause of infectious complications with impact on patient and graft outcomes. Our objective was to verify the safety and efficacy of transurethral injection of Durasphere (R) to relieve RTP secondary to VUR after renal transplantation. Patients and methods: Between June 2004 and July 2008, eight patients with RTP (defined as two or more episodes of pyelonephritis after transplantation) and VUR to the KTx were treated with subureteral injections of Durasphere (R). The mean age at surgery was 38.8 +/- 13.8 yr (23-65). The patients were followed regularly every six months. The mean interval between the KTx and the treatment was 76 +/- 74.1 (10-238 months). The mean follow-up was 22.3 +/- 16.1 months (8-57 months). Results: Six patients (75%) were free of pyelonephritis during a mean period of follow-up of 23.2 +/- 17.1 months (8-57 months). Two of them had no VUR and four cases presented with G II VUR (pre-operative G IV three cases and one case G III). In one case, symptomatic recurrent cystitis made a second treatment necessary. This patient remained free of infections for three yr after the first treatment and for 18 months after the second treatment. Of the remaining two patients, one had six episodes of RTP before treatment in a period of three yr and only two episodes after treatment in two yr of follow-up. The last case had a new episode of pyelonephritis five months after treatment. Conclusions: Transurethral injection therapy with Durasphere (R) is a safe and effective minimally invasive treatment option for KTx patients with recurrent RTP. A second treatment seems to be necessary in some cases.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Despite modern reanimation surgical techniques, facial paralysis presents with functional and aesthetic deficits. We evaluated facial symmetry after treating with botulinum toxin the healthy side of the face of 25 patients with long-standing facial paralysis who had previously been treated by surgical methods, with 6 months follow-up. Evaluation consisted of a clinical score, the two subscales of the Facial Disability Index, and surface electromyography. The mean botulinum toxin dose was 38 +/- A 5 U (range = 15-69 U). The clinical score showed significant reduction of asymmetry of 48.4% at 1 month and 16.8% after 6 months. The initial result was a consequence of reduced motion on the treated side combined with better motion on the paralyzed side. At 6 months, the treated side returned to basal scores. The residual effect seen in symmetry was due to an increase (18%) of motion in the paralyzed side. There was a significant decrease in the action potential of muscles on the nonparalyzed side 1 month post injection but completely reverted after 6 months. The Physical Function Index increased, but not significantly. The Social/Well-Being Function Index showed a significant increase at 6 months compared to pretreatment. The proposed treatment improved facial symmetry for up to 6 months. Even after the end of the clinical effect of the drug, the paralyzed side`s clinical score was 18% higher than pretreatment, with an increased quality of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective. Previously we showed that after intravenous injection a lipidic nanoemulsion concentrates in breast carcinoma tissue and other solid tumors and may carry drugs directed against neoplastic tissues. Use of the nanoemulsion decreases toxicity of the chemotherapeutic agents without decreasing the anticancer action. Currently, the hypothesis was tested whether the nanoemulsion concentrates in breast carcinoma tissue after locoregional injection. Methods. Three different techniques of injection of the nanoemulsion were tested in patients scheduled for surgical treatment: G1 (n=4) into the mammary tissue 5 cm away from the tumor; G2 (n=4) into the peritumoral mammary tissue; G3 (n=6) into the tumoral tissue. The nanoemulsion labeled with radioactive cholesteryl oleate was injected 12 h before surgery; plasma decay of the label was determined from blood samples collected over 24 h and the tissue fragments excised during the surgery were analyzed for radioactivity uptake. Results. Among the three nanoemulsion injection techniques, G3 showed the greatest uptake (data expressed in c.p.m/g of tissue) by the tumor (44,769 +/- 54,749) and by the lymph node (2356 +/- 2966), as well as the greatest concentration in tumor compared to normal tissue (844 +/- 1673). In G1 and G2, uptakes were, respectively, tumor: 60 +/- 71 and 843 +/- 1526; lymph node: 263 +/- 375 and 102 +/- 74; normal tissue: 139 +/- 102 and 217 +/- 413. Conclusions. Therefore, with intralesional injection of the nanoemulsion, a great concentration effect can be achieved. This injection technique may be thus a promising approach for drug-targeting in neoadjuvant chemotherapy in breast cancer treatment. (C) 2008 Published by Elsevier Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Myocardial infarction remains as a major cause of mortality worldwide and a high rate of survivors develop heart failure as a sequel, resulting in a high morbidity and elevated expenditures for health system resources. We have designed a multicenter trial to test for the efficacy of autologous bone marrow (ABM) mononuclear cell (MC) transplantation in this subgroup of patients. The main hypothesis to be tested is that treated patients will have a significantly higher ejection fraction (EF) improvement after 6 months than controls. Methods: A sample of 300 patients admitted with ST elevation acute myocardial infarction (STEMI) and left ventricle (LV) systolic dysfunction, and submitted to successful mechanical or chemical recanalization of the infarct-related coronary artery will be selected for inclusion and randomized to either treated or control group in a double blind manner. The former group will receive 100 x 106 MC suspended in saline with 5% autologous serum in the culprit vessel, while the latter will receive placebo (saline with 5% autologous serum). Implications: Many phase I/II clinical trials using cell therapy for STEMI have been reported, demonstrating that cell transplantation is safe and may lead to better preserved LV function. Patients with high risk to develop systolic dysfunction have the potential to benefit more. Larger randomized, double blind and controlled trials to test for the efficacy of cell therapies in patients with high risk for developing heart failure are required.