Mutation of Pro-258 in transmembrane domain 6 constitutively activates the G protein-coupled alpha-factor receptor.

The alpha-factor pheromone receptor stimulates MATa yeast cells to undergo conjugation. The receptor contains seven transmembrane domains that function in ligand binding and in transducing a signal to the cytoplasmic receptor sequences to mediate G protein activation. A genetic screen was used to isolate receptor mutations that constitutively signal in the absence of alpha-factor. The Pro-258-->Leu (P258L) mutation caused constitutive receptor signaling that was equivalent to about 45% of the maximum level observed in wild-type cells stimulated with alpha-factor. Mutations of both Pro-258 and the adjacent Ser-259 to Leu increased constitutive signaling to > or = 90% of the maximum level. Since Pro-258 occurs in the central portion of transmembrane domain 6, and since proline residues are expected to cause a kink in alpha-helical domains, the P258L mutation is predicted to alter the structure of transmembrane domain 6. The P258L mutation did not result in a global distortion of receptor structure because alpha-factor bound to the mutant receptors with high affinity and induced even higher levels of signaling. These results suggest that sequences surrounding Pro-258 may be involved in ligand activation of the receptor. Conformational changes in transmembrane domain 6 may effect a change in the adjacent sequences in the third intracellular loop that are thought to function in G protein activation. Greater than 90% of all G protein-coupled receptors contain a proline residue at a similar position in transmembrane domain 6, suggesting that this aspect of receptor activation may be conserved in other receptors.

Cloning and expression of apoptosis inhibitory protein homologs that function to inhibit apoptosis and/or bind tumor necrosis factor receptor-associated factors.

Baculovirus inhibitors of apoptosis (IAPs) act in insect cells to prevent cell death. Here we describe three mammalian homologs of IAP, MIHA, MIHB, and MIHC, and a Drosophila IAP homolog, DIHA. Each protein bears three baculovirus IAP repeats and an N-terminal ring finger motif. Apoptosis mediated by interleukin 1beta converting enzyme (ICE), which can be inhibited by Orgyia pseudotsugata nuclear polyhedrosis virus IAP (OpIAP) and cowpox virus crmA, was also inhibited by MIHA and MIHB. As MIHB and MIHC were able to bind to the tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 in yeast two-hybrid assays, these results suggest that IAP proteins that inhibit apoptosis may do so by regulating signals required for activation of ICE-like proteases.

Constitutive production of granulocyte/macrophage colony-stimulating factor by hypodense mononuclear eosinophils developed in vitro from hybrid eosinophil/basophil granulocytes.

We recently described the development in vitro of cells with granules characteristic of eosinophils and basophils (hybrid granulocytes) from normal human cord blood mononuclear cells cultured for 14 days with recombinant human (rh) interleukin (IL)-3, rhIL-5, and a soluble basement membrane, Matrigel. Hybrid granulocytes constitutively produced granulocyte/macrophage colony-stimulating factor (GM-CSF) and rapidly developed into eosinophils after the exogenous cytokines and Matrigel were removed. To characterize the developmental progression of hybrid granulocytes, cells were maintained for an additional 14 days in medium containing rhIL-3, rhIL-5, and Matrigel. After 28 days, 73% +/- 1% (mean +/- SEM; n = 6) of the nonadherent cells were mononuclear eosinophils, 13% +/- 3% were eosinophils with two or more nuclear lobes, 13% +/- 4% were hybrid granulocytes, and 0.2% +/- 0.1% were basophils. More than 90% of the mononuclear eosinophils were hypodense as determined by centrifugation through metrizamide gradients. After an additional 5 days of culture in medium without exogenous cytokines, 65% +/- 3% (n = 5) of the 28-day cells excluded trypan blue. In contrast, 2% +/- 1% of freshly isolated peripheral blood eosinophils survived 5 days of culture without exogenous cytokines (n = 5). Fifty percent conditioned medium from in vitro derived 28-day mononuclear eosinophils and 14-day hybrid granulocytes maintained the survival of 60% +/- 7% and 77% +/- 7%, respectively, of freshly isolated peripheral blood eosinophils for 72 h, compared with 20% +/- 8% survival in medium alone (n = 3). The eosinophil viability-sustaining activity of 50% mononuclear eosinophil-conditioned medium was neutralized with a GM-CSF antibody. A total of 88% of the 28-day cells exhibited immunochemical staining for GM-CSF. Thus, during eosinophilopoiesis, both hybrid eosinophil/basophil intermediates and immature mononuclear eosinophils exhibit autocrine regulation of viability due to constitutive production of GM-CSF.

Stimulation of growth factor receptor signal transduction by activation of voltage-sensitive calcium channels.

To understand the mechanisms by which electrical activity may generate long-term responses in the nervous system, we examined how activation of voltage-sensitive calcium channels (VSCCs) can stimulate the Ras/mitogen-activated protein kinase (MAPK) signaling pathway. Calcium influx through L-type VSCCs leads to tyrosine phosphorylation of the adaptor protein Shc and its association with the adaptor protein Grb2, which is bound to the guanine nucleotide exchange factor Sos1. In response to calcium influx, Shc, Grb2, and Sos1 inducibly associate with a 180-kDa tyrosine-phosphorylated protein, which was determined to be the epidermal growth factor receptor (EGFR). Calcium influx induces tyrosine phosphorylation of the EGFR to levels that can activate the MAPK signaling pathway. Thus, ion channel activation stimulates growth factor receptor signal transduction.

A family of transmembrane proteins with homology to the MET-hepatocyte growth factor receptor.

In hunting for unknown genes on the human X chromosome, we identified a cDNA in Xq28 encoding a transmembrane protein (SEX) of 1871 amino acids. SEX shares significant homology with the extracellular domain of the receptors encoded by the oncogenes MET, RON, and SEA [hepatocyte growth factor (HGF) receptor family]. Further screenings of cDNA libraries identified three additional sequences closely related to SEX: these were named SEP, OCT, and NOV and were located on human chromosomes 3p, 1, and 3q, respectively. The proteins encoded by these genes contain large cytoplasmic domains characterized by a distinctive highly conserved sequence (SEX domain). Northern blot analysis revealed different expression of the SEX family of genes in fetal tissues, with SEX, OCT, and NOV predominantly expressed in brain, and SEP expressed at highest levels in kidney. In situ hybridization analysis revealed that SEX has a distinctive pattern of expression in the developing nervous system of the mouse, where it is found in postmitotic neurons from the first stages of neuronal differentiation (9.5 day postcoitus). The SEX protein (220 kDa) is glycosylated and exposed at the cell surface. Unlike the receptors of the HGF family, p220SEX, a MET-SEX chimera or a constitutively dimerized TPR-SEX does not show tyrosine kinase activity. These data define a gene family (SEX family) involved in the development of neural and epithelial tissues, which encodes putative receptors with unexpected enzymatic or binding properties.

Tissue-specific response of the human platelet-activating factor receptor gene to retinoic acid and thyroid hormone by alternative promoter usage.

We have studied the effects of retinoic acid (RA) and thyroid hormone (3,3',5-triiodothyronine; T3) on platelet-activating factor receptor (PAFR) gene expression in intact rats and the ability of two human PAFR gene promoters (PAFR promoters 1 and 2) to generate two transcripts (PAFR transcripts 1 and 2). Northern blotting showed that RA and T3 regulated PAFR gene expression only in rat tissues that express PAFR transcript 2. Functional analysis of the human PAFR promoter 2 revealed that responsiveness to RA and T3 was conferred through a 24-bp element [PAFR-hormone response element (HRE) located from -67 to -44 bp of the transcription start site, whereas PAFR promoter 1 did not respond to these hormones. The PAFR-HRE is composed of three direct repeated TGACCT-like hexamer motifs with 2-and 4-bp spaces, and the two upstream and two downstream motifs were identified as response elements for RA and T3. Thus, the PAF-PAFR pathway is regulated by the PAFR level altered by a tissue-specific response to RA and T3 through the PAFR-HRE of the PAFR promoter 2.

Unimpaired autoreactive T-cell traffic within the central nervous system during tumor necrosis factor receptor-mediated inhibition of experimental autoimmune encephalomyelitis.

The critical role of tumor necrosis factor (TNF) as a mediator in autoimmune inflammatory processes is evident from in vivo studies with TNF-blocking agents. However, the mechanisms by which TNF, and possibly also its homologue lymphotoxin alpha, contributes to development of pathology in rheumatoid arthritis and Crohn disease and in animal models like experimental autoimmune encephalomyelitis is unclear. Possibilities include regulation of vascular adhesion molecules enabling leukocyte movement into tissues or direct cytokine-mediated effector functions such as mediation of tissue damage. Here we show that administration of a TNF receptor (55 kDa)-IgG fusion protein prevented clinical signs of actively induced experimental autoimmune encephalomyelitis. Significantly, the total number of CD4+ T lymphocytes isolated from the central nervous system of clinically healthy treated versus diseased control animals was comparable. By using a CD45 congenic model of passively transferred experimental autoimmune encephalomyelitis to enable tracking of myelin basic protein-specific effector T lymphocytes, prevention of clinical signs of disease was again demonstrated in treated animals but without quantitative or qualitative impediment to the movement of autoreactive T lymphocytes to and within the central nervous system. Thus, despite the uninterrupted movement of specific T lymphocytes into the target tissue, subsequent disease development was blocked. This provides compelling evidence for a direct effector role of TNF/lymphotoxin alpha in autoimmune tissue damage.

p56Lck and p59Fyn regulate CD28 binding to phosphatidylinositol 3-kinase, growth factor receptor-bound protein GRB-2, and T cell-specific protein-tyrosine kinase ITK: implications for T-cell costimulation.

T-cell activation requires cooperative signals generated by the T-cell antigen receptor zeta-chain complex (TCR zeta-CD3) and the costimulatory antigen CD28. CD28 interacts with three intracellular proteins-phosphatidylinositol 3-kinase (PI 3-kinase), T cell-specific protein-tyrosine kinase ITK (formerly TSK or EMT), and the complex between growth factor receptor-bound protein 2 and son of sevenless guanine nucleotide exchange protein (GRB-2-SOS). PI 3-kinase and GRB-2 bind to the CD28 phosphotyrosine-based Tyr-Met-Asn-Met motif by means of intrinsic Src-homology 2 (SH2) domains. The requirement for tyrosine phosphorylation of the Tyr-Met-Asn-Met motif for SH2 domain binding implicates an intervening protein-tyrosine kinase in the recruitment of PI 3-kinase and GRB-2 by CD28. Candidate kinases include p56Lck, p59Fyn, zeta-chain-associated 70-kDa protein (ZAP-70), and ITK. In this study, we demonstrate in coexpression studies that p56Lck and p59Fyn phosphorylate CD28 primarily at Tyr-191 of the Tyr-Met-Asn-Met motif, inducing a 3- to 8-fold increase in p85 (subunit of PI 3-kinase) and GRB-2 SH2 binding to CD28. Phosphatase digestion of CD28 eliminated binding. In contrast to Src kinases, ZAP-70 and ITK failed to induce these events. Further, ITK binding to CD28 was dependent on the presence of p56Lck and is thus likely to act downstream of p56Lck/p59Fyn in a signaling cascade. p56Lck is therefore likely to be a central switch in T-cell activation, with the dual function of regulating CD28-mediated costimulation as well as TCR-CD3-CD4 signaling.

Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E.

To develop a murine model system to test the role of monocyte-derived macrophage in atherosclerosis, the osteopetrotic (op) mutation in the macrophage colony-stimulating factor gene was bred onto the apolipoprotein E (apoE)-deficient background. The doubly mutant (op/apoE-deficient) mice fed a low-fat chow diet had significantly smaller proximal aortic lesions at an earlier stage of progression than their apoE-deficient control littermates. These lesions in the doubly mutant mice were composed of macrophage foam cells. The op/apoE-deficient mice also had decreased body weights, decreased blood monocyte differentials, and increased mean cholesterol levels of approximately 1300 mg/dl. Statistical analysis determined that atherosclerosis lesion area was significantly affected by the op genotype and gender. The confounding variables of body weight, plasma cholesterol, and monocyte differential, which were all affected by op genotype, had no significant additional effect on lesion area once they were adjusted for the effects of op genotype and gender. Unexpectedly, there was a significant inverse correlation between plasma cholesterol and lesion area, implying that each may be the result of a common effect of macrophage colony-stimulating factor levels. The data support the hypothesis that macrophage colony-stimulating factor and its effects on macrophage development and function play a key role in atherogenesis.

Potentiation of epidermal growth factor receptor-mediated oncogenesis by c-Src: implications for the etiology of multiple human cancers.

c-Src is a nontransforming tyrosine kinase that participates in signaling events mediated by a variety of polypeptide growth factor receptors, including the epidermal growth factor receptor (EGFR). Overexpression and continual ligand stimulation of the EGFR results in morphological transformation of cells in vitro and tumor development in vivo. Elevated levels of c-Src and the EGFR are found in a variety of human malignancies, raising the question of whether c-Src can functionally cooperate with the EGFR during tumorigenesis. To address this issue, we generated c-Src/EGFR double overexpressors and compared their proliferative and biochemical characteristics to those of single overexpressors and control cells. We found that in cells expressing high levels of receptor, c-Src potentiated DNA synthesis, growth in soft agar, and tumor formation in nude mice. Growth potentiation was associated with the formation of a heterocomplex between c-Src and activated EGFR, the appearance of a distinct tyrosyl phosphorylation on the receptor, and an enhancement of receptor substrate phosphorylation. These findings indicate that c-Src is capable of potentiating receptor-mediated tumorigenesis and suggest that synergism between c-Src and the EGFR may contribute to a more aggressive phenotype in multiple human tumors.

A kinase associated with chromatin that can be activated by ligand-p185c-Neu or epidermal growth factor-receptor interactions.

Some growth factors transduce positive growth signals, while others can act as growth inhibitors. Nuclear signaling events of previously quiescent cells stimulated with various growth factors have been studied by isolating the complexed chromatin-associated proteins and chromatin-associated proteins. Signals from the plasma membrane are integrated within the cells and quickly transduced to the nucleus. It is clear that several growth factors, such as epidermal growth factor, transforming growth factor alpha (but not transforming growth factor beta), and platelet-derived growth factor, utilize similar intracellular signaling biochemistries to modulate nucleosomal characteristics. The very rapid and consistent phosphorylation of nuclear p33, p54, and low molecular mass proteins in the range of 15-18 kDa after growth factor stimulation implies that there is a coordination and integration of the cellular signaling processes. Additionally, phosphorylation of p33 and some low molecular mass histones has been found to occur within 5 min of growth factor treatment and to reach a maximum by 30 min. In this study, we report that Neu receptor activating factor also utilizes the same signaling mechanism and causes p33 to become phosphorylated. In addition, both the tumor promoter okadaic acid (which inhibits protein phosphatases 1 and 2A) and phorbol ester (phorbol 12-tetradecanoate 13-acetate) stimulate phosphorylation of p33, p54, and low molecular mass histones. However, transforming growth factor beta, which is a growth inhibitor for fibroblasts, fails to increase p33 phosphorylation. In general, p33 phosphorylation patterns correspond to positive and negative mitogenic signal transduction. p33 isolated from the complexed chromatin-associated protein fraction appears to be a kinase, or tightly associated with a kinase, and shares antigenicity with the cell division cycle-dependent Cdk2 kinase as determined by antibody-dependent analysis. The rapid phosphorylation of nucleosomal proteins may influence sets of early genes needed for the induction and progression of the cell cycle.

Cell acidification in apoptosis: granulocyte colony-stimulating factor delays programmed cell death in neutrophils by up-regulating the vacuolar H(+)-ATPase.

Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Delivery of antisense oligodeoxyribonucleotides against the human epidermal growth factor receptor into cultured KB cells with liposomes conjugated to folate via polyethylene glycol.

Antisense oligodeoxyribonucleotides targeted to the epidermal growth factor (EGF) receptor were encapsulated into liposomes linked to folate via a polyethylene glycol spacer (folate-PEG-liposomes) and efficiently delivered into cultured KB cells via folate receptor-mediated endocytosis. The oligonucleotides were a phosphodiester 15-mer antisense to the EGF receptor (EGFR) gene stop codon (AEGFR2), the same sequence with three phosphorothioate linkages at each terminus (AEGFR2S), a randomized 15-mer control of similar base composition to AEGFR2 (RC15), a 14-mer control derived from a symmetrized Escherichia coli lac operator (LACM), and the 5'-fluorescein-labeled homologs of several of the above. Cellular uptake of AEGFR2 encapsulated in folate-PEG-liposomes was nine times higher than AEGFR2 encapsulated in nontargeted liposomes and 16 times higher than unencapsulated AEGFR2. Treatment of KB cells with AEGFR2 in folate-PEG-liposomes resulted in growth inhibition and significant morphological changes. Curiously, AEGFR2 and AEGFR2S encapsulated in folate-PEG-liposomes exhibited virtually identical growth inhibitory effects, reducing KB cell proliferation by > 90% 48 hr after the cells were treated for 4 hr with 3 microM oligonucleotide. Free AEGFR2 caused almost no growth inhibition, whereas free AEGFR2S was only one-fifth as potent as the folate-PEG-liposome-encapsulated oligonucleotide. Growth inhibition of the oligonucleotide-treated cells was probably due to reduced EGFR expression because indirect immunofluorescence staining of the cells with a monoclonal antibody against the EGFR showed an almost quantitative reduction of the EGFR in cells treated with folate-PEG-liposome-entrapped AEGFR2. These results suggest that antisense oligonucleotide encapsulation in folate-PEG-liposomes promise efficient and tumor-specific delivery and that phosphorothioate oligonucleotides appear to offer no major advantage over native phosphodiester DNA when delivered by this route.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.