987 resultados para Site-selective Dephosphorylation


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Photodynamic therapy involves administration of a photosensitizing drug and its subsequent activation by visible light of the appropriate wavelength. Several approaches to increasing the specificity of photosensitizers for cancerous tissues and, in particular, through their conjugation to ligands that are directed against tumor-associated antigens have been investigated. Here, we have studied the delivery of the photocytotoxic porphyrin compound TPP(p-O-beta-D-GluOH)(3) into tumor cells that overexpress the glycosphingolipid Gb3, using the Gb3-binding nontoxic B-subunit of Shiga toxin (STxB) as a vector. To allow for site-directed chemical coupling, an STxB variant carrying a free sulfhydryl moiety at its C-terminal end has been used. Binding affinity, cellular uptake, singlet oxygen quantum yield, and phototoxicity of the conjugate have been examined. Despite some effect of coupling on both the photophysical properties of TPP(p-O-beta-D-GluOH)(3) and the affinity of STxB for its receptor, the conjugate exhibited a higher photocytotoxic activity than the photosensitizer alone and was exquisitely selective for Gb3-expressing tumor cells. Furthermore, our data strongly suggest that STxB-mediated retrograde delivery of the photosensitizer to the biosynthetic/secretory pathway is critical for optimal cytotoxic activity. In conclusion, a strong rationale for using retrograde delivery tools such as STxB in combination with photosensitizing agents for the photodynamic therapy of tumors is presented.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The inferior colliculus (IC) together with the dorsal periaqueductal gray (dPAG), the amygdala and the medial hypothalamus make part of the brain aversion system, which has mainly been related to the organization of unconditioned fear. However, the involvement of the IC and dPAG in the conditioned fear is still unclear. It is certain that GABA has a regulatory role on the aversive states generated and elaborated in these midbrain structures. In this study, we evaluated the effects of injections of the GABA-A receptor agonist muscimol (1.0 and 2.0 nmol/0.2 mu L) into the IC or dPAG on the freezing and fear-potentiated startle (FPS) responses of rats submitted to a context fear conditioning. Intra-IC injections of muscimol did not cause any significant effect on the FPS or conditioned freezing but enhanced the startle reflex in non-conditioned animals. In contrast, intra-dPAG injections of muscimol caused significant reduction in FPS and conditioned freezing without changing the startle reflex in non-conditioned animals. Thus, intra-dPAG injections of muscimol produced the expected inhibitory effects on the anxiety-related responses, the FPS and the freezing whereas these injections into the IC produced quite opposite effects suggesting that descending inhibitory pathways from the IC, probably mediated by GABA-A mechanisms, exert a regulatory role on the lower brainstem circuits responsible for the startle reflex. (C) 2008 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Independent brain circuits appear to underlie different forms of conditioned fear, depending on the type of conditioning used, such as a context or explicit cue paired with footshocks. Several clinical reports have associated damage to the medial temporal lobe (MTL) with retrograde amnesia. Although a number of studies have elucidated the neural circuits underlying conditioned fear, the involvement of MTL components in the aversive conditioning paradigm is still unclear. To address this issue, we assessed freezing responses and Fos protein expression in subregions of the rhinal cortex and ventral hippocampus of rats following exposure to a context, light or tone previously paired with footshock (Experiment 1). A comparable degree of freezing was observed in the three types of conditioned fear, but with distinct patterns of Fos distribution. The groups exposed to cued fear conditioning did not show changes in Fos expression, whereas the group subjected to contextual fear conditioning showed selective activation of the ectorhinal (Ect), perirhinal (Per), and entorhinal (Ent) cortices, with no changes in the ventral hippocampus. We then examined the effects of the benzodiazepine midazolam injected bilaterally into these three rhinal subregions in the expression of contextual fear conditioning (Experiment 2). Midazolam administration into the Ect, Per, and Ent reduced freezing responses. These findings suggest that contextual and explicit stimuli endowed with aversive properties through conditioning recruit distinct brain areas, and the rhinal cortex appears to be critical for storing context-, but not explicit cue-footshock, associations. (C) 2010 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Experiments were conducted to investigate the effect of Lolium rigidum (annual ryegrass) seed developmental stage and application rate of glyphosate and SpraySeed (paraquat 135 g/L+ diquat 115 g/L) on the number, germinability, and fitness of seeds produced. Glyphosate (450 g/L) was most effective when applied at a rate of 0.5-1 L/ha during heading and anthesis, reducing the number of filled seeds produced compared with unsprayed plants. Application post-anthesis, when seeds were at the milk to soft dough stage, was less effective. SpraySeed was most effective when applied post-anthesis, during the milk and early dough stages of seed development at a rate of 0.5-1L/ha, resulting in the production of few viable seeds. Although some filled seeds were produced, most of the seeds were dead. Application during anthesis or once the seeds reached soft dough stage was less effective. For both herbicides, those seeds that were capable of germinating were smaller and had slower radicle and coleoptile growth, resulting in slower early seedling growth and reduced biomass production within the first month of growth. Additionally, glyphosate application reduced the proportion of seeds exhibiting dormancy. The anticipated reduction in seed competitive ability and altered emergence timing resulting from late-season herbicide application, even when application timing is not optimal, could be exploited to reduce the likelihood of successful L. rigidum establishment in the following season.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Vagal Denervation and Neurally Mediated Syncope. A 15-year-old female patient presented with frequent episodes of vasovagal syncope refractory to non-pharmacological and pharmacological measures. Two tilt-table tests performed before and after conventional therapy were positive and reproduced the patient`s clinical symptoms. Selective vagal denervation, guided by HFS, was performed. Six radiofrequency pulses were applied on the left and right sides of the interatrial septum, abolishing vagal responses at these locations. Basal sinus node and Wenckebach cycle lengths changed significantly following ablation. A tilt test performed after denervation was negative and revealed autonomic tone modification. The patient reported significant improvement in quality of life and remained asymptomatic for 9 months after denervation. After this period, three episodes of NMS occurred during a 4-month interval and a tilt test performed 11 months after the procedure demonstrated vagal activity recovery. (J Cardiovasc Electrophysiol, Vol. 20, pp. 558-563, May 2009).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. The GlyR comprises a pentameric complex that forms a chloride-selective transmembrane channel, which is predominantly expressed in the spinal cord and brain stem. We review the pharmacological and physiological properties of the GlyR and relate this information to more recent insights that have been obtained through the cloning and recombinant expression of the GlyR subunits. We also discuss insights into our understanding of GlyR structure and function that have been obtained by the genetic characterisation of various heritable disorders of glycinergic neurotransmission. (C) 1997 Elsevier Science Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Extensive lymphocyte apoptosis may be an important cause of immune suppression in sepsis. Here we investigated the effect of LPS tolerance on lymphocyte apoptosis in an experimental model of polymicrobial infection. Tolerance was induced by the injection of lipopolysaccharide (1.0 mg/kg/subcutaneously) once a day for 5 days. Macroarray analysis of mRNA isolated from T-(CD4) lymphocytes was used to identify genes that are differentially expressed during LPS tolerance. In addition, assessment of the expression of apoptosis-associated lymphocyte gene products and apoptotic events was performed on the 8th day; 6 h after the terminal challenge with polymicrobial infection or high-dose LPS administration. Survival studies with polymicrobial infection were also conducted. LPS tolerance induced a broad reprogramming of cell death pathways, including a suppression of receptor-mediated and mitochondrial apoptotic pathways, inflammatory caspases, alternate apoptotic pathways, as well as reduced expression of genes involved in necrosis. These alterations led to a marked resistance of lymphocytes against cell death during the subsequent period of sepsis. In addition, LPS tolerance produced an increased differentiation of T-lymphocytes to T(H)1 and T(H)2, with a T(H)1 differentiation predominance. Thus, in the current study we provide an evidence for a marked reprogramming of gene expression of multiple cell death pathways during LPS tolerance. These alterations may play a significant role in the observed protection of the animals from a subsequent lethal polymicrobial sepsis challenge. (C) 2009 Elsevier GmbH. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: We introduce a technique for performing a selective amygdalohippocampectomy (AH) through a minisupraorbital approach. METHODS: A minisupraorbital craniotomy and an anterior selective AH were performed in 8 cadaver heads (16 sides). The anatomic specimens were analyzed, and the extent of resection of the hippocampus and amygdala was evaluated. Surgically relevant measurements were performed using anatomic specimens. An image-guided system was used to document the extent of the anterior AH. Laboratory data were used to support the clinical application of the technique. RESULTS: The anterior route allowed removal of the amygdala and hippocampus, as confirmed by anatomic assessment. The image-guided system and anatomic evaluation confirmed that the amygdala and hippocampus can be accessed and removed through this route. The mean distance between the anterior aspect of the uncus and the tip of the temporal horn was 17.0 +/- 4.6 mm; the mean distance from the head of the hippocampus to the posterior border of the cerebral peduncles was 26.0 +/- 3.2 mm. Clinical application resulted in satisfactory removal of the amygdala and hippocampus. CONCLUSION: The anterior route for selective AH is a logical and straightforward approach to the mesial temporal lobe. Compared with other variations, it is less invasive and destructive, especially in terms of the fibers of the optic pathway, temporal stem, and lateral temporal neocortex.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: Restoration of nerve continuity and effective maintenance of coaptation are considered fundamental principles of end-to-end peripheral nerve repair. OBJECTIVE: To evaluate the influence of the number of stitches on axonal regeneration and collagen production after neurorrhaphy. METHODS: Thirty male Wistar rats were equally divided into 3 groups and were all operated on with the right sciatic nerve exposed. In 2 groups, the nerve was sectioned and repaired by means of 3 (group B) or 6 (group C) epineurium sutures with 100 monofilament nylon. One group (group A) was used as a control. Each animal from groups B and C underwent electrophysiological evaluation with motor action potential recordings before nerve section and again at an 8-week interval after neurorrhaphy. Nerve biopsy specimens were used for histomorphometric assessment of axonal regeneration and quantification of collagen at the repair site. RESULTS: Animals from group C had significantly lower motor action potential conduction velocities compared with control animals (P = .02), and no significant difference was seen between groups B and C. Parameters obtained from morphometric evaluation were not significantly different between these 2 groups. Type I collagen and III collagen in the epineurium were significantly higher in group C than in either the control group (P = .001 and P = .003) or group B (P = .01 and P = .02). No differences were identified for collagen I and III in the endoneurium. CONCLUSION: Using 6 sutures for nerve repair is associated with worse electrophysiological outcomes and higher amounts of type I and III collagen in the epineurium compared with control. Neurorraphy with 6 stitches is also related to a significant increase in epineurium collagen I and III compared with 3-stitch neurorraphy.