Neutron structure of type-III antifreeze protein allows the reconstruction of AFP-ice interface.

Antifreeze proteins (AFPs) inhibit ice growth at sub-zero temperatures. The prototypical type-III AFPs have been extensively studied, notably by X-ray crystallography, solid-state and solution NMR, and mutagenesis, leading to the identification of a compound ice-binding surface (IBS) composed of two adjacent ice-binding sections, each which binds to particular lattice planes of ice crystals, poisoning their growth. This surface, including many hydrophobic and some hydrophilic residues, has been extensively used to model the interaction of AFP with ice. Experimentally observed water molecules facing the IBS have been used in an attempt to validate these models. However, these trials have been hindered by the limited capability of X-ray crystallography to reliably identify all water molecules of the hydration layer. Due to the strong diffraction signal from both the oxygen and deuterium atoms, neutron diffraction provides a more effective way to determine the water molecule positions (as D(2) O). Here we report the successful structure determination at 293 K of fully perdeuterated type-III AFP by joint X-ray and neutron diffraction providing a very detailed description of the protein and its solvent structure. X-ray data were collected to a resolution of 1.05 Å, and neutron Laue data to a resolution of 1.85 Å with a "radically small" crystal volume of 0.13 mm(3). The identification of a tetrahedral water cluster in nuclear scattering density maps has allowed the reconstruction of the IBS-bound ice crystal primary prismatic face. Analysis of the interactions between the IBS and the bound ice crystal primary prismatic face indicates the role of the hydrophobic residues, which are found to bind inside the holes of the ice surface, thus explaining the specificity of AFPs for ice versus water.

Neutron skin of 208Pb, nuclear symmetry energy, and the parity radius experiment

A precise determination of the neutron skin thickness of a heavy nucleus sets a basic constraint on the nuclear symmetry energy (the neutron skin thickness is the difference of the neutron and proton rms radii of the nucleus). The parity radius experiment (PREX) may achieve it by electroweak parity-violating electron scattering (PVES) on 208Pb. We investigate PVES in nuclear mean field approach to allow the accurate extraction of the neutron skin thickness of 208Pb from the parity-violating asymmetry probed in the experiment. We demonstrate a high linear correlation between the parity-violating asymmetry and the neutron skin thickness in successful mean field forces as the best means to constrain the neutron skin of 208Pb from PREX, without assumptions on the neutron density shape. Continuation of the experiment with higher precision in the parity-violating asymmetry is motivated since the present method can support it to constrain the density slope of the nuclear symmetry energy to new accuracy.

Pairing with polarization effects in low-density neutron matter

We study the properties of the 1S0 pairing gap in low-density neutron matter. Different corrections to the lowest-order scattering length approximation are explored, resulting in a strong suppression with respect to the BCS result.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Influence of the halo upon angular distributions for elastic scattering and breakup

The angular distributions for elastic scattering and breakup of halo nuclei are analysed using a near-side/far-side decomposition within the framework of the dynamical eikonal approximation. This analysis is performed for (11)Be impinging on Pb at 69 MeV/nucleon. These distributions exhibit very similar features. In particular they are both near-side dominated, as expected from Coulomb-dominated reactions. The general shape of these distributions is sensitive mostly to the projectile-target interactions, but is also affected by the extension of the halo. This suggests the elastic scattering not to be affected by a loss of flux towards the breakup channel. (C) 2010 Elsevier B.V. All rights reserved.

Canonical quantum potential scattering theory

A new formulation of potential scattering in quantum mechanics is developed using a close structural analogy between partial waves and the classical dynamics of many non-interacting fields. Using a canonical formalism we find nonlinear first-order differential equations for the low-energy scattering parameters such as scattering length and effective range. They significantly simplify typical calculations, as we illustrate for atom-atom and neutron-nucleus scattering systems. A generalization to charged particle scattering is also possible.

Structure of large two-neutron halos in light exotic nuclei

The structure of three-body halo nuclei formed by two neutrons and a core (nnc) is studied using zero-range interactions. The halo wave function can be completely parameterized only by the s-wave scattering lengths and two-neutron separation energy. The sizes and the neutron-neutron correlation function of Li-11 and Be-14 are calculated and compared to experimental data. A general classification scheme for three-body halos with two identical particles is discussed as well as the critical conditions to allow excited Efimov states.

Trajectory of neutron-neutron-C-18 excited three-body state

The trajectory of the first excited Efimov state is investigated by using a renormalized zero-range three-body model for a system with two bound and one virtual two-body subsystems. The approach is applied to n-n-C-18, where the n-n virtual energy and the three-body ground state are kept fixed. It is shown that such three-body excited state goes from a bound to a virtual state when the n-C-18 binding energy is increased. Results obtained for the n-C-19 elastic cross-section at low energies also show dominance of an S-matrix pole corresponding to a bound or virtual Efimov state. It is also presented a brief discussion of these findings in the context of ultracold atom physics with tunable scattering lengths. (C) 2008 Elsevier B.V. All rights reserved.

Light scattering on the structural characterization of DMPG vesicles along the bilayer anomalous phase transition

Highly charged vesicles of the saturated anionic lipid dimyristoyl phosphatidylglycerol (DMPG) in low ionic strength medium exhibit a very peculiar thermo-structural behavior. Along a wide gel-fluid transition region, DMPG dispersions display several anomalous characteristics, like low turbidity, high electrical conductivity and viscosity. Here, static and dynamic light scattering (SLS and DLS) were used to characterize DMPG vesicles at different temperatures. Similar experiments were performed with the largely studied zwitterionic lipid dimyristoyl phosphatidylcholine (DMPC). SLS and DLS data yielded similar dimensions for DMPC vesicles at all studied temperatures. However, for DMPG, along the gel-fluid transition region, SLS indicated a threefold increase in the vesicle radius of gyration, whereas the hydrodynamic radius, as obtained from DLS, increased 30% only. Despite the anomalous increase in the radius of gyration, DMPG lipid vesicles maintain isotropy, since no light depolarization was detected. Hence, SLS data are interpreted regarding the presence of isotropic vesicles within the DMPG anomalous transition, but highly perforated vesicles, with large holes. DLS/SLS discrepancy along the DMPG transition region is discussed in terms of the interpretation of the Einstein-Stokes relation for porous vesicles. Therefore, SLS data are shown to be much more appropriate for measuring porous vesicle dimensions than the vesicle diffusion coefficient. The underlying nanoscopic process which leads to the opening of pores in charged DMPG bilayer is very intriguing and deserves further investigation. One could envisage biotechnological applications, with vesicles being produced to enlarge and perforate in a chosen temperature and/or pH value. (C) 2012 Elsevier Ireland Ltd. All rights reserved.

Gaussian deconvolution: a useful method for a form-free modeling of scattering data from mono- and multilayered planar systems

A new method for analysis of scattering data from lamellar bilayer systems is presented. The method employs a form-free description of the cross-section structure of the bilayer and the fit is performed directly to the scattering data, introducing also a structure factor when required. The cross-section structure (electron density profile in the case of X-ray scattering) is described by a set of Gaussian functions and the technique is termed Gaussian deconvolution. The coefficients of the Gaussians are optimized using a constrained least-squares routine that induces smoothness of the electron density profile. The optimization is coupled with the point-of-inflection method for determining the optimal weight of the smoothness. With the new approach, it is possible to optimize simultaneously the form factor, structure factor and several other parameters in the model. The applicability of this method is demonstrated by using it in a study of a multilamellar system composed of lecithin bilayers, where the form factor and structure factor are obtained simultaneously, and the obtained results provided new insight into this very well known system.

Investigation of the nuclear matter density distributions of the exotic 12 Be, 14 Be and 8 B nuclei by elastic proton scattering in inverse kinematics

The proton-nucleus elastic scattering at intermediate energies is a well-established method for the investigation of the nuclear matter distribution in stable nuclei and was recently applied also for the investigation of radioactive nuclei using the method of inverse kinematics. In the current experiment, the differential cross sections for proton elastic scattering on the isotopes $^{7,9,10,11,12,14}$Be and $^8$B were measured. The experiment was performed using the fragment separator at GSI, Darmstadt to produce the radioactive beams. The main part of the experimental setup was the time projection ionization chamber IKAR which was simultaneously used as hydrogen target and a detector for the recoil protons. Auxiliary detectors for projectile tracking and isotope identification were also installed. As results from the experiment, the absolute differential cross sections d$sigma$/d$t$ as a function of the four momentum transfer $t$ were obtained. In this work the differential cross sections for elastic p-$^{12}$Be, p-$^{14}$Be and p-$^{8}$B scattering at low $t$ ($t leq$~0.05~(GeV/c)$^2$) are presented. The measured cross sections were analyzed within the Glauber multiple-scattering theory using different density parameterizations, and the nuclear matter density distributions and radii of the investigated isotopes were determined. The analysis of the differential cross section for the isotope $^{14}$Be shows that a good description of the experimental data is obtained when density distributions consisting of separate core and halo components are used. The determined {it rms} matter radius is $3.11 pm 0.04 pm 0.13$~fm. In the case of the $^{12}$Be nucleus the results showed an extended matter distribution as well. For this nucleus a matter radius of $2.82 pm 0.03 pm 0.12$~fm was determined. An interesting result is that the free $^{12}$Be nucleus behaves differently from the core of $^{14}$Be and is much more extended than it. The data were also compared with theoretical densities calculated within the FMD and the few-body models. In the case of $^{14}$Be, the calculated cross sections describe the experimental data well while, in the case of $^{12}$Be there are discrepancies in the region of high momentum transfer. Preliminary experimental results for the isotope $^8$B are also presented. An extended matter distribution was obtained (though much more compact as compared to the neutron halos). A proton halo structure was observed for the first time with the proton elastic scattering method. The deduced matter radius is $2.60pm 0.02pm 0.26$~fm. The data were compared with microscopic calculations in the frame of the FMD model and reasonable agreement was observed. The results obtained in the present analysis are in most cases consistent with the previous experimental studies of the same isotopes with different experimental methods (total interaction and reaction cross section measurements, momentum distribution measurements). For future investigation of the structure of exotic nuclei a universal detector system EXL is being developed. It will be installed at the NESR at the future FAIR facility where higher intensity beams of radioactive ions are expected. The usage of storage ring techniques provides high luminosity and low background experimental conditions. Results from the feasibility studies of the EXL detector setup, performed at the present ESR storage ring, are presented.

Fast and accurate numerical solutions in some problems of particle and radiation transport: synthetic acceleration for the method of short characteristics, Doppler-broadened scattering kernel, remote sensing of the cryosphere

The aim of this work is to present various aspects of numerical simulation of particle and radiation transport for industrial and environmental protection applications, to enable the analysis of complex physical processes in a fast, reliable, and efficient way. In the first part we deal with speed-up of numerical simulation of neutron transport for nuclear reactor core analysis. The convergence properties of the source iteration scheme of the Method of Characteristics applied to be heterogeneous structured geometries has been enhanced by means of Boundary Projection Acceleration, enabling the study of 2D and 3D geometries with transport theory without spatial homogenization. The computational performances have been verified with the C5G7 2D and 3D benchmarks, showing a sensible reduction of iterations and CPU time. The second part is devoted to the study of temperature-dependent elastic scattering of neutrons for heavy isotopes near to the thermal zone. A numerical computation of the Doppler convolution of the elastic scattering kernel based on the gas model is presented, for a general energy dependent cross section and scattering law in the center of mass system. The range of integration has been optimized employing a numerical cutoff, allowing a faster numerical evaluation of the convolution integral. Legendre moments of the transfer kernel are subsequently obtained by direct quadrature and a numerical analysis of the convergence is presented. In the third part we focus our attention to remote sensing applications of radiative transfer employed to investigate the Earth's cryosphere. The photon transport equation is applied to simulate reflectivity of glaciers varying the age of the layer of snow or ice, its thickness, the presence or not other underlying layers, the degree of dust included in the snow, creating a framework able to decipher spectral signals collected by orbiting detectors.

Messung des elektrischen Neutron-Formfaktors in der Reaktion 3 He(e,e'n)pp bei Q 2 = 1.58 (GeV/c) 2

Die elektromagnetischen Nukleon-Formfaktoren sind fundamentale Größen, welche eng mit der elektromagnetischen Struktur der Nukleonen zusammenhängen. Der Verlauf der elektrischen und magnetischen Sachs-Formfaktoren G_E und G_M gegen Q^2, das negative Quadrat des Viererimpulsübertrags im elektromagnetischen Streuprozess, steht über die Fouriertransformation in direkter Beziehung zu der räumlichen Ladungs- und Strom-Verteilung in den Nukleonen. Präzise Messungen der Formfaktoren über einen weiten Q^2-Bereich werden daher für ein quantitatives Verständnis der Nukleonstruktur benötigt.rnrnDa es keine freien Neutrontargets gibt, gestaltet sich die Messung der Neutron-Formfaktoren schwierig im Vergleich zu der Messung am Proton. Konsequenz daraus ist, dass die Genauigkeit der vorhandenen Daten von Neutron-Formfaktoren deutlich geringer ist als die von Formfaktoren des Protons; auch der vermessene Q^2-Bereich ist kleiner. Insbesondere der elektrische Sachs-Formfaktor des Neutrons G_E^n ist schwierig zu messen, da er aufgrund der verschwindenden Nettoladung des Neutrons im Verhältnis zu den übrigen Nukleon-Formfaktoren sehr klein ist. G_E^n charakterisiert die Ladungsverteilung des elektrisch neutralen Neutrons und ist damit besonders sensitiv auf die innere Struktur des Neutrons.rnrnIn der hier vorgestellten Arbeit wurde G_E^n aus Strahlhelizitätsasymmetrien in der quasielastischen Streuung vec{3He}(vec{e}, e'n)pp bei einem Impulsübertrag von Q^2 = 1.58 (GeV/c)^2 bestimmt. Die Messung fand in Mainz an der Elektronbeschleunigeranlage Mainzer Mikrotron innerhalb der A1-Kollaboration im Sommer 2008 statt. rnrnLongitudinal polarisierte Elektronen mit einer Energie von 1.508 GeV wurden an einem polarisierten ^3He-Gastarget, das als effektives, polarisiertes Neutrontarget diente, gestreut. Die gestreuten Elektronen wurden in Koinzidenz mit den herausgeschlagenen Neutronen detektiert; die Elektronen wurden in einem magnetischen Spektrometer nachgewiesen, durch den Nachweis der Neutronen in einer Matrix aus Plastikszintillatoren wurde der Beitrag der quasielastischen Streuung am Proton unterdrückt.rnrnAsymmetrien des Wirkungsquerschnitts bezüglich der Elektronhelizität sind bei Orientierung der Targetpolarisation in der Streuebene und senkrecht zum Impulsübertrag sensitiv auf G_E^n / G_M^n; mittels deren Messung kann G_E^n bestimmt werden, da der magnetische Formfaktor G_M^n mit vergleichsweise hoher Präzision bekannt ist. Zusätzliche Messungen der Asymmetrie bei einer Polarisationsorientierung parallel zum Impulsübertrag wurden genutzt, um systematische Fehler zu reduzieren.rnrnFür die Messung inklusive statistischem (stat) und systematischem (sys) Fehler ergab sich G_E^n = 0.0244 +/- 0.0057_stat +/- 0.0016_sys.

Parity violating asymmetry in the electron deuteron quasielastic scattering, strange vector and axial vector form factors and beam normal spin asymmetries

In dieser Arbeit wurde die paritätsverletzende Asymmetrie in derrnquasielastischen Elektron-Deuteron-Streuung bei Q^2=0.23 (GeV/c)^2 mitrneinem longitudinal polarisierten Elektronstrahl bei einer Energie von 315rnMeV bestimmt. Die Messung erfolgte unter Rückwärtswinkeln. Der Detektor überdeckte einen polaren Streuwinkelbereichrnzwischen 140 und 150 deg. Das Target bestand aus flüssigemrnDeuterium in einer Targetzelle mit einer Länge von 23.4 cm. Dierngemessene paritätsverletzende Asymmetrie beträgt A_{PV}^d = (-20.11 pm 0.87_{stat} pm 1.03_{syst}), wobei der erste Fehler den statistischenrnFehlereitrag und der zweite den systematischen Fehlerbeitrag beschreibt. Ausrnder Kombination dieser Messung mit Messungen der paritätsverletzendenrnAsymmetrie in der elastischen Elektron-Proton-Streuung bei gleichem Q^2rnsowohl bei Vorwärts- als auch bei Rückwärtsmessungen können diernVektor-Strange-Formfaktoren sowie der effektive isovektorielle und isoskalarernVektorstrom des Protons, der die elektroschwachen radiativen Anapolkorrekturenrnenthält, bestimmt werden. Diese Arbeit umfasst ausserdem die Bestimmungrnder Asymmetrien bei einem transversal polarisierten Elektronstrahl sowohl beirneinem Proton- als auch einem Deuterontarget unter Rückwärtswinkeln beirnImpulsüberträgen von Q^2=0.10 (GeV/c)^2, Q^2=0.23 (GeV/c)^2rnund Q^2=0.35 (GeV/c)^2. Die im Experiment beobachteten Asymmetrien werdenrnmit theoretischen Berechnungen verglichen, welche den Imaginärteil der Zweiphoton-Austauschamplitude beinhalten.