Autocrine/paracrine role of insulin-related growth factors in neurogenesis: local expression and effects on cell proliferation and differentiation in retina.

Early neurogenesis progresses by an initial massive proliferation of neuroepithelial cells followed by a sequential differentiation of the various mature neural cell types. The regulation of these processes by growth factors is poorly understood. We intend to understand, in a well-defined biological system, the embryonic chicken retina, the role of the insulin-related growth factors in neurogenesis. We demonstrate the local presence of signaling elements together with a biological response to the factors. Neuroretina at days 6-8 of embryonic development (E6-E8) expressed proinsulin/insulin and insulin-like growth factor I (IGF-I) mRNAs as well as insulin receptor and IGF type I receptor mRNAs. In parallel with this in vivo gene expression, E5 cultured neuroretinas synthesized and released to the medium a metabolically radiolabeled immunoprecipitable insulin-related peptide. Furthermore, insulin-related immunoreactive material with a HPLC mobility close to that of proinsulin was found in the E6-E8 vitreous humor. Exogenous chicken IGF-I, human insulin, and human proinsulin added to E6 cultured neuroretinas showed relatively close potencies stimulating proliferation, as determined by [methyl-3H]thymidine incorporation, with a plateau reached at 10(-8) M. These factors also stimulated neuronal differentiation, indicated by the expression of the neuron-specific antigen G4. Thus, insulin-related growth factors, interestingly including proinsulin, are present in the developing chicken retina and appear to play an autocrine/paracrine stimulatory role in the progression of neurogenesis.

Li-Fraumeni syndrome fibroblasts homozygous for p53 mutations are deficient in global DNA repair but exhibit normal transcription-coupled repair and enhanced UV resistance.

We investigated whether mutations in the p53 tumor suppressor gene alter UV sensitivity and/or repair of UV-induced DNA damage in primary human skin fibroblasts from patients with Li-Fraumeni syndrome, heterozygous for mutations in one allele of the p53 gene (p53 wt/mut) and sublines expressing only mutant p53 (p53 mut). The p53 mut cells were more resistant than the p53 wt/mut cells to UV cytotoxicity and exhibited less UV-induced apoptosis. DNA repair analysis revealed reduced removal of cyclobutane pyrimidine dimers from overall genomic DNA in vivo in p53 mut cells compared with p53 wt/mut or normal cells. However, p53 mut cells retained the ability to preferentially repair damage in the transcribed strands of expressed genes (transcription-coupled repair). These results suggest that loss of p53 function may lead to greater genomic instability by reducing the efficiency of DNA repair but that cellular resistance to DNA-damaging agents may be enhanced through elimination of apoptosis.

Capturing genes encoding membrane and secreted proteins important for mouse development.

A strategy based on the gene trap was developed to prescreen mouse embryonic stem cells for insertional mutations in genes encoding secreted and membrane-spanning proteins. The "secretory trap" relies on capturing the N-terminal signal sequence of an endogenous gene to generate an active beta-galactosidase fusion protein. Insertions were found in a cadherin gene, an unc6-related laminin (netrin) gene, the sek receptor tyrosine kinase gene, and genes encoding two receptor-linked protein-tyrosine phosphatases, LAR and PTP kappa. Analysis of homozygous mice carrying insertions in LAR and PTP kappa showed that both genes were effectively disrupted, but neither was essential for normal embryonic development.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Expression of the HPV16E7 oncoprotein by thymic epithelium is accompanied by disrupted T cell maturation and a failure of the thymus to involute with age

Transgenic mice expressing the E7 protein of HPV16 from the keratin 14 promoter demonstrate increasing thymic hypertrophy with age. This hypertrophy is associated with increased absolute numbers of all thymocyte types, and with increased cortical and medullary cellularity. In the thymic medulla, increased compartmentalization of the major thymic stromal cell types and expansion of thymic epithelial cell population is observed. Neither an increased rate of immature thymocyte division nor a decreased rate of immature thymocyte death was able to account for the observed hypertrophy. Thymocytes with reduced levels of expression of CD4 and/or CD8 were more abundant in transgenic (tg) mice and became increasingly more so with age. These thymic SP and DP populations with reduced levels of CD4 and/or CD8 markers had a lower rate of apoptosis in the tg than in the non-tg mice. The rate of export of mature thymocytes to peripheral lymphoid organs was less in tg animals relative to the pool of available mature cells, particularly for the increasingly abundant CD4lo population. We therefore suggest that mature thymocytes that would normally die in the thymus gradually accumulated in E7 transgenic animals, perhaps as a consequence of exposure to a hypertrophied E7-expressing thymic epithelium or to factors secreted by this expanded thymic stromal cell population. The K14E7 transgenic mouse thus provides a unique model to study effects of the thymic epithelial cell compartment on thymus development and involution.

Gene-expression profiling reveals distinct expression patterns for classic versus variant Merkel cell phenotypes and new classifier genes to distinguish Merkel cell from small-cell lung carcinoma

Merkel cell carcinoma (MCC) is a rare aggressive skin tumor which shares histopathological and genetic features with small-cell lung carcinoma (SCLC), both are of neuroendocrine origin. Comparable to SCLC, MCC cell lines are classified into two different biochemical subgroups designated as 'Classic' and 'Variant'. With the aim to identify typical gene-expression signatures associated with these phenotypically different MCC cell lines subgroups and to search for differentially expressed genes between MCC and SCLC, we used cDNA arrays to pro. le 10 MCC cell lines and four SCLC cell lines. Using significance analysis of microarrays, we defined a set of 76 differentially expressed genes that allowed unequivocal identification of Classic and Variant MCC subgroups. We assume that the differential expression levels of some of these genes reflect, analogous to SCLC, the different biological and clinical properties of Classic and Variant MCC phenotypes. Therefore, they may serve as useful prognostic markers and potential targets for the development of new therapeutic interventions specific for each subgroup. Moreover, our analysis identified 17 powerful classifier genes capable of discriminating MCC from SCLC. Real-time quantitative RT-PCR analysis of these genes on 26 additional MCC and SCLC samples confirmed their diagnostic classification potential, opening opportunities for new investigations into these aggressive cancers.

Myoepithelial calls: Pathology, cell separation and markers of myoepithelial differentiation

Until recently the myoepithelial cell has been studied relatively little in terms of its role in breast cancer. A number of malignancies showing myoepithelial differentiation have been reported in the literature, although they are still thought to be relatively rare and only limited studies are published. As a result of recent expression profiling experiments, one type of tumor with myoepithelial features, the so-called 'basal' breast cancer, has received a renewed interest, although it has been known to pathologists for more than two decades. These tumors, which express markers of both luminal and myoepithelial cells, are now being studied using antibodies against some new molecules that have emerged from studies of sorted normal luminal and myoepithelial cells. These immunohistochemical data, combined with genomic studies, may lead to better identification and management of patients with 'basal' tumors.

Identification of membrane-bound and secreted proteins from Echinococcus granulosus by signal sequence trap

The signal sequence trap technique was applied to identify genes coding for secreted and membrane bound proteins from Echinococcus granulosus, the etiologic agent of cystic hydatid disease. An E. granulosus protoscolex cDNA library was constructed in the AP-PST vector such that randomly primed cDNAs were fused with a placental alkaline phosphatase reporter gene lacking its endogenous signal peptide. E. granulosus cDNAs encoding a functional signal peptide were selected by their ability to rescue secretion of alkaline phosphatase by COS-7 cells that had been transfected with the cDNA library. Eighteen positive clones were identified and sequenced. Their deduced amino acid sequences showed significant similarity with amino acid transporters, Krebs cycle intermediates transporters, presenilins and vacuolar protein sorter proteins. Other cDNAs encoded secreted proteins without homologues. Three sequences were transcribed antisense to E. granulosus expressed sequence tags. All the mRNAs were expressed in protoscoleces and adult worms, but some of them were not found in oncospheres. The putative E. granulosus secreted and membrane bound proteins identified are likely to play important roles in the metabolism, development and survival in the host and represent potential targets for diagnosis, drugs and vaccines against E. granulosus. (c) 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Host-bacteria interactions : Host cell responses and bacterial pathogenesis

Helicobacter pylori colonizes the human stomach, where it causes gastritis that may develop into peptic ulcer disease or cancer when left untreated. Neisseria gonorrhoeae colonizes the urogenital tract and causes the sexually transmitted disease gonorrhea. In contrast, Lactobacillus species are part of the human microbiota, which is the resident microbial community, and are considered to be beneficial for health. The first host cell types that bacteria encounter when they enter the body are epithelial cells, which form the border between the inside and the outside, and macrophages, which are immune cells that engulf unwanted material.       The focus of this thesis has been the interaction between the host and bacteria, aiming to increase our knowledge of the molecular mechanisms that underlie the host responses and their effects on bacterial pathogenicity. Understanding the interactions between bacteria and the host will hopefully enable the development of new strategies for the treatment of infectious disease. In paper I, we investigated the effect of N. gonorrhoeae on the growth factor amphiregulin in cervical epithelial cells and found that the processing and release of amphiregulin changes upon infection. In paper II, we examined the expression of the transcription factor early growth response-1 (EGR1) in epithelial cells during bacterial colonization. We demonstrated that EGR1 is rapidly upregulated by many different bacteria. This upregulation is independent of the pathogenicity, Gram-staining type and level of adherence of the bacteria, but generally requires viable bacteria and contact with the host cell. The induction of EGR1 is mediated primarily by signaling through EGFR, ERK1/2 and β1-integrins. In paper III, we described the interactions of the uncharacterized protein JHP0290, which is secreted by H. pylori, with host cells. JHP0290 is able to bind to several cell types and induces apoptosis and TNF release in macrophages. For both of these responses, signaling through Src family kinases and ERK is essential. Apoptosis is partially mediated by TNF release. Finally, in paper IV, we showed that certain Lactobacillus strains can reduce the colonization of H. pylori on gastric epithelial cells. Lactobacilli decrease the gene expression of SabA and thereby inhibit the binding mediated by this adhesin.

Aberrant reactive oxygen and nitrogen species generation in rheumatoid arthritis (RA):causes and consequences for immune function, cell survival, and therapeutic intervention

The infiltration and persistence of hematopoietic immune cells within the rheumatoid arthritis (RA) joint results in elevated levels of pro-inflammatory cytokines, increased reactive oxygen (ROS) and -nitrogen (RNS) species generation, that feeds a continuous self-perpetuating cycle of inflammation and destruction. Meanwhile, the controlled production of ROS is required for signaling within the normal physiological reaction to perceived "foreign matter" and for effective apoptosis. This review focuses on the signaling pathways responsible for the induction of the normal immune response and the contribution of ROS to this process. Evidence for defects in the ability of immune cells in RA to regulate the generation of ROS and the consequence for their immune function and for RA progression is considered. As the hypercellularity of the rheumatoid joint and the associated persistence of hematopoietic cells within the rheumatoid joint are symptomatic of unresponsiveness to apoptotic stimuli, the role of apoptotic signaling proteins (specifically Bcl-2 family members and the tumor suppressor p53) as regulators of ROS generation and apoptosis are considered, evaluating evidence for their aberrant expression and function in RA. We postulate that ROS generation is required for effective therapeutic intervention.

Regulation of beta-cell viability and gene expression by distinct agonist fragments of adiponectin

Obesity is an established risk factor for type 2 diabetes. Activation of the adiponectin receptors has a clear role in improving insulin resistance although conflicting evidence exists for its effects on pancreatic beta-cells. Previous reports have identified both adiponectin receptors (ADR-1 and ADR-2) in the beta-cell. Recent evidence has suggested that two distinct regions of the adiponectin molecule, the globular domain and a small N-terminal region, have agonist properties. This study investigates the effects of two agonist regions of adiponectin on insulin secretion, gene expression, cell viability and cell signalling in the rat beta-cell line BRIN-BD11, as well as investigating the expression levels of adiponectin receptors (ADRs) in these cells. Cells were treated with globular adiponectin and adiponectin (15-36) +/-leptin to investigate cell viability, expression of key beta-cell genes and ERK1/2 activation. Both globular adiponectin and adiponectin (15-36) caused significant ERK1/2 dependent increases in cell viability. Leptin co-incubation attenuated adiponectin (15-36) but not globular adiponectin induced cell viability. Globular adiponectin, but not adiponectin (15-36), caused a significant 450% increase in PDX-1 expression and a 45% decrease in LPL expression. ADR-1 was expressed at a higher level than ADR-2, and ADR mRNA levels were differentially regulated by non-esterified fatty acids and peroxisome-proliferator-activated receptor agonists. These data provide evidence of roles for two distinct adiponectin agonist domains in the beta-cell and confirm the potentially important role of adiponectin receptor agonism in maintaining beta-cell mass.

Autocrine activity of soluble Flt-1 controls endothelial cell function and angiogenesis

Background - The negative feedback system is an important physiological regulatory mechanism controlling angiogenesis. Soluble vascular endothelial growth factor (VEGF) receptor-1 (sFlt-1), acts as a potent endogenous soluble inhibitor of VEGF- and placenta growth factor (PlGF)-mediated biological function and can also form dominant-negative complexes with competent full-length VEGF receptors. Methods and results - Systemic overexpression of VEGF-A in mice resulted in significantly elevated circulating sFlt-1. In addition, stimulation of human umbilical vein endothelial cells (HUVEC) with VEGF-A, induced a five-fold increase in sFlt-1 mRNA, a time-dependent significant increase in the release of sFlt-1 into the culture medium and activation of the flt-1 gene promoter. This response was dependent on VEGF receptor-2 (VEGFR-2) and phosphoinositide-3'-kinase signalling. siRNA-mediated knockdown of sFlt-1 in HUVEC stimulated the activation of endothelial nitric oxide synthase, increased basal and VEGF-induced cell migration and enhanced endothelial tube formation on growth factor reduced Matrigel. In contrast, adenoviral overexpression of sFlt-1 suppressed phosphorylation of VEGFR-2 at tyrosine 951 and ERK-1/-2 MAPK and reduced HUVEC proliferation. Preeclampsia is associated with elevated placental and systemic sFlt-1. Phosphorylation of VEGFR-2 tyrosine 951 was greatly reduced in placenta from preeclamptic patients compared to gestationally-matched normal placenta. Conclusion - These results show that endothelial sFlt-1 expression is regulated by VEGF and acts as an autocrine regulator of endothelial cell function.

Maternal nutrition modifies trophoblast giant cell phenotype and fetal growth in mice

Mammalian placentation is dependent upon the action of trophoblast cells at the time of implantation. Appropriate fetal growth, regulated by maternal nutrition and nutrient transport across the placenta, is a critical factor for adult offspring long-term health. We have demonstrated that a mouse maternal low-protein diet (LPD) fed exclusively during preimplantation development (Emb-LPD) increases offspring growth but programmes adult cardiovascular and metabolic disease. In this study, we investigate the impact of maternal nutrition on post-implantation trophoblast phenotype and fetal growth. Ectoplacental cone explants were isolated at day 8 of gestation from female mice fed either normal protein diet (NPD: 18% casein), LPD (9% casein) or Emb-LPD and cultured in vitro. We observed enhanced spreading and cell division within proliferative and secondary trophoblast giant cells (TGCs) emerging from explants isolated from LPD-fed females when compared with NPD and Emb-LPD explants after 24 and 48 h. Moreover, both LPD and Emb-LPD explants showed substantial expansion of TGC area during 24-48 h, not observed in NPD. No difference in invasive capacity was observed between treatments using Matrigel transwell migration assays. At day 17 of gestation, LPD- and Emb-LPD-fed conceptuses displayed smaller placentas and larger fetuses respectively, resulting in increased fetal:placental ratios in both groups compared with NPD conceptuses. Analysis of placental and yolk sac nutrient signalling within the mammalian target of rapamycin complex 1 pathway revealed similar levels of total and phosphorylated downstream targets across groups. These data demonstrate that early post-implantation embryos modify trophoblast phenotype to regulate fetal growth under conditions of poor maternal nutrition.

Flt1 acts as a negative regulator of tip cell formation and branching morphogenesis in the zebrafish embryo

Endothelial tip cells guide angiogenic sprouts by exploring the local environment for guidance cues such as vascular endothelial growth factor (VegfA). Here we present Flt1 (Vegf receptor 1) loss- and gain-of-function data in zebrafish showing that Flt1 regulates tip cell formation and arterial branching morphogenesis. Zebrafish embryos expressed soluble Flt1 (sFlt1) and membrane-bound Flt1 (mFlt1). In Tg(flt1(BAC):yfp) × Tg(kdrl:ras-cherry)(s916) embryos, flt1:yfp was expressed in tip, stalk and base cells of segmental artery sprouts and overlapped with kdrl:cherry expression in these domains. flt1 morphants showed increased tip cell numbers, enhanced angiogenic behavior and hyperbranching of segmental artery sprouts. The additional arterial branches developed into functional vessels carrying blood flow. In support of a functional role for the extracellular VEGF-binding domain of Flt1, overexpression of sflt1 or mflt1 rescued aberrant branching in flt1 morphants, and overexpression of sflt1 or mflt1 in controls resulted in short arterial sprouts with reduced numbers of filopodia. flt1 morphants showed reduced expression of Notch receptors and of the Notch downstream target efnb2a, and ectopic expression of flt4 in arteries, consistent with loss of Notch signaling. Conditional overexpression of the notch1a intracellular cleaved domain in flt1 morphants restored segmental artery patterning. The developing nervous system of the trunk contributed to the distribution of Flt1, and the loss of flt1 affected neurons. Thus, Flt1 acts in a Notch-dependent manner as a negative regulator of tip cell differentiation and branching. Flt1 distribution may be fine-tuned, involving interactions with the developing nervous system.

Multiparameter flow cytometric analysis of C -reactive protein binding to human-derived cell lines and peripheral blood monocytes

C-reactive protein (CRP), a normally occurring human plasma protein may become elevated as much as 1,000 fold during disease states involving acute inflammation or tissue damage. Through its binding to phosphorylcholine in the presence of calcium, CRP has been shown to potentiate the activation of complement, stimulate phagocytosis and opsonize certain microorganisms. Utilizing a flow cytometric functional ligand binding assay I have demonstrated that a monocyte population in human peripheral blood and specific human-derived myelomonocytic cell lines reproducibly bind an evolutionarily conserved conformational pentraxin epitope on human CRP through a mechanism that does not involve its ligand, phosphorylcholine. ^ A variety of cell lines at different stages of differentiation were examined. The monocytic cell line, THP-1, bound the most CRP followed by U937 and KG-1a cells. The HL-60 cell line was induced towards either the granulocyte or monocyte pathway with DMSO or PMA, respectively. Untreated HL-60 cells or DMSO-treated cells did not bind CRP while cells treated with PMA showed increased binding of CRP, similar to U-937 cells. T cell and B-cell derived lines were negative. ^ Inhibition studies with Limulin and human SAP demonstrated that the binding site is a conserved pentraxin epitope. The calcium requirement necessary for binding to occur indicated that the cells recognize a conformational form of CRP. Phosphorylcholine did not inhibit the reaction therefore the possibility that CRP had bound to damaged membranes with exposed PC sites was discounted. ^ A study of 81 normal donors using flow cytometry demonstrated that a majority of peripheral blood monocytes (67.9 ± 1.3, mean ± sem) bound CRP. The percentage of binding was normally distributed and not affected by gender, age or ethnicity. Whole blood obtained from donors representing a variety of disease states showed a significant reduction in the level of CRP bound by monocytes in those donors classified with infection, inflammation or cancer. This reduction in monocyte populations binding CRP did not correlate with the concentration of plasma CRP. ^ The ability of monocytes to specifically bind CRP combined with the binding reactivity of the protein itself to a variety of phosphorylcholine containing substances may represent an important bridge between innate and adaptive immunity. ^