999 resultados para Espaço. Historiografia. Memória. João Pessoa


Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study aimed to validate the technology at Bed Bath System, in view of bedridden elderly and their caregivers, with a view to transforming the conventional paradigm regarding the practice of bodily hygiene held in bath chairs adapted in long-stay institutions for the elderly. This is an experimental study involving 51 (fifty one) elderly and 17 (seventeen) caregivers of three long-stay institutions for the elderly of the city of João Pessoa. For data collection, applied initially to cognitive assessment scale Mini Mental State Examination, with the aim of tracking the subject group of elderly cognitively able to participate in the study. In the second phase, to measure the percentage of agreement and disagreement about the attributes of the subjects of the shower chair and adapted the system for bed bath, used a questionnaire with closed questions, Likert scale model of four (4) points, with a good reliability index (0.728), estimated by alpha conbrach, evidenced by the Wilcoxon test a significant difference (P<0.05) between the responses of seniors and caregivers about the attributes involving technology system in bath bed and bath chair adapted, confirming the perspective of the subjects that the two systems differ significantly. However, the system bed bath got greater degree of agreement for their use, characterizing this system is a technology that makes the differential bed bath pleasurable action, quality and humanized

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Um envelhecer saudável compreende fundamentalmente, o atendimento de necessidades que vão além da manutenção de um bom estado de saúde física. Faz-se necessário valorizar o idoso como pessoa socialmente útil, favorecendo, direta e indiretamente, o idoso, a família e comunidade para o alcance de um estilo de vida desejável. Pautando-se nessas reflexões, a partir da importância de um estudo em que se procure avaliar até que ponto, segmentos da sociedade e o próprio idoso, conhecem os direitos deste, e com isto, procurar pontuar conceitos de cidadania, vinculando os idosos a essas práticas, tendo como ponto de partida neste estudo, a saúde, como prática muito questionada no cotidiano. Este estudo, portanto, tem como objetivo verificar o conhecimento de estudantes universitários sobre os direitos do idoso no que se refere à saúde, contemplados no Estatuto do Idoso e explorar os direitos do idoso no âmbito da saúde na concepção de estudantes universitários. Trata-se de um estudo exploratório descritivo, numa abordagem qualitativa, centrando-se na análise dos aspectos legais (jurídicos) sobre o conhecimento dos direitos do idoso no âmbito da saúde pelos estudantes e sua implicação na prática da cidadania. O estudo foi realizado na cidade de João Pessoa - Pb, estudantes universitários de diferentes cursos do Campus I da Universidade Federal da Paraiba. O instrumento utilizado para coleta de dados foi uma entrevista semi-estruturada. Os coletados foram qualitativamente, explorando-se as falas dos sujeitos, utilizando-se a técnica de análise de conteúdo temática categorial. Os resultados encontram-se apresentados em quadros e temas. A partir de diferentes artigos realizados no decorrer do curso. Diante da expressividade dos resultados encontrados nesta pesquisa, é possível afirmar que os estudantes universitários ainda conhecem pouco o direito dos idosos, em particular, no campo da saúde, mesmo os estudantes da referida área. No contexto interdisciplinar este estudo sugere ações dirigidas à população do estudo propiciando pesquisas com maior impacto na mídia dirigida tanto aos idosos como a sociedade em geral

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This work is an attempt to show that the ideological conflict that has been developed by the hegemony of the 1930 Revolution historical events in Paraíba, conceptually turned into an insoluble social contradiction. It ocurred due to imaginary or formal resolutions of the literature that ended up by altering the epistemological rules of the relation between fiction and reality. The present work is based on The unconscious politics: a narrative as a socially symbolic act , book in which all the literary or cultural texts can and should be read as symbolic resolutions to insoluble social contradictions. From string to contemporary literature this phenomenon has been registered by the several ways of textual production turning the 1930 Revolution into one of the main elements which guides the political scene of Paraíba. The ideological groups still centered on the political resentment and committed to a political conflict forged the existence of two historical truths: one which suits the liberais , the winners, and another is of the 1930 conflict. This work argues in favour of the unconscious politics of the 1930 Revolution. This thesis considers necessarily the relation that the Paraibana society maintains with its past and how this past reaches in the present the liberation of a hidden and repressed truth through its narrativization. Beyond that, how the ideological partiality generated the political resentment through the way of thinking of the rivals under the perspective of the good and evil reveals its insoluble social contradiction. Process which comprehends varied narrative forms of the mass culture products and literary production, as in the methodological perspective pointed by Fredric Jameson that all literary or cultural texts can and shall be read as symbolic resolutions of true political and social contradictions. In the case of Paraiba we will have resolutions that search for the reasons which caused the death of João Pessoa: forgery and publicity of love letters, dispute over the official version of suicide commited by João Dantas, the man who assassinated João Pessoa

Relevância:

100.00% 100.00%

Publicador:

Resumo:

El objetivo de este estudio consistió en capturar y reconstituir el modo por el cual profesoras y profesores vinculados a la educación infantil y a la fase inicial de la enseñanza fundamental producen su identidad docente, en el contexto de una tardía profesionalización. El campo de esa pesquisa envolvió tres instituciones públicas de enseñanza superior, dos en Natal (RN) y una en João Pessoa (PB), que desenvulven programas especiales de formación de docentes vinculados a las respectivas redes locales de enseñanza. Para el atendimiento del objetivo arriba propuesto, fue utilizada la teoría de las representaciones sociales para la captura de los elementos constitutivos de las representaciones sociales del profesorado conforme la formulación de Serge Moscovici y colaboradores, considerándose, aqui, especialmente, la contribución de Abric en su complementar teoría de nucleo central de las representaciones. Teniendo en vista la necesidad de identificación de los elementos estructuradores de las representaciones, y definidores de las identidades en cuestión, se privilegió en la pesquisa la producción discursiva docente y sus condiciones de producción. La utilización de sus evocaciones, bien como de las fuentes escritas por los propios sujetos envolvidos, oportunizó el afloramiento de las diferentes faces constitutivas del ser profesor/a . El corpus decorriente de ese estudio fue entonces somentido a una serie de diferentes métodos / técnicas condensadas en programas informatizados y otros manuales en um esfuerzo para conferir un mayor rigor al análisis de los resultados apuntados. Se utilizó, aún, un referencial de análisis del discurso para viabilizar la emergencia de diferentes ângulos de la configuracion de la identidad en foco. Los resultados apuntam para un significativo deslocamiento de las representaciones docentes, bien como permitem afirmar la hipótesis, inicialmente puesta, de que la profesionalización docente ocurre no apenas de manera tardía, como también viene provocando una resignificación de los referentes de identidad de esos profesionales

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Nossa Senhora da Conceição Seminary, installed in 1894, by Dom Adauto Aurélio de Miranda Henriques, first Paraíba Bishop, and the Episcopal Seminary of the Sagrado Coração de Jesus, implanted in 1913, by Dom José Thomas Gomes da Silva, first Aracaju s Bishop diocese, were created as a result of lack of an official religious process proposed by the Brazilian Republic Proclamation, in 1889. With the appoint to enlarge the number of priests and change the image of the priest married and unrolled who used to identify the Catholic Church in the colonial and imperial Brazil. Such bishops developed into intellectuals in the government, dioceses and formation priest houses. I take as a study object, for this doctorate paper, the academic formation and priesthood developed in theses seminaries, from 1894 to 1933, once 1894 the year of João Pessoa Creation Seminar that was implied the Minor Course (preparation) and the Major one (built by Philosophy and God related studies) and the research limit year of 1933, is concerned about the Major Sergipe Seminary ending, which was created and has worked offering the Minor and Major courses, from 1913 to 1933. Showing the teaching models that guided and leaded the priest formation, referred as Seminaries, and the application result is the objective of this investigation. To comprehend the teaching models seminaries studied, my research line is the Catholic Church theme and priest formation in Brazil. In front of the object and the objective desired, I chose the historical comparative method and the scholars modals notions of Araujo de Barros (2004) and the Sirinelli intellectuals (1996). Such references allowed me to analyze the formation given in the seminary and seminarian participation and actions, included the sequence after the scholars formation. The thesis defended is that the teaching model developed in the Brazilian Seminaries, created after a non official religious process in the Brazilian government, deal with a model of one unique center (Seminary formation and aim pre arranged by Santa Sé), although adapted, presuming the local reality and formation structure (privileged not only spiritual and moral speaking, but intellectual also), was it responsible for intellectuals generations (teachers priests, educationalist priest, journalists priests and so on) that boost the education in Brazil. During the Republic first three decades, when, in thesis, the Government was becoming free religion, i.e., the government did not subsidize the Church anymore, and the Government, among others aspects, did not received any Church care to help the public teaching in the country. The investigation reveled accede, by bishops and their followers, such as by the Concílio de Trento pre concept, or by the others ideas, leading by the priests formation in Seminaries. By creating and stalling diocese Seminary, Bishop Dom Adauto and Dom José went further their functions, by the time they built inside themselves a teaching model thought from the main pedagogic logic, based on several religious exercises, moral and ethic, considered by themselves several knowledge connected to humanity, philosophy and God related studies). Following clearly rationalism principle (the way of teaching, which each subject has its own teacher and this class get together students with the same knowledge, regardless of age) and efficiency (trying to teach the whole content in each class), the Seminaries researched developed a whole education, allowed the structure of a spiritual education, moral and intellectual, for a quality developed by priests, including different levels that they used to performance. Their bottom line, actions and priest matter achievement allowed their broad fulfillment, in the way that priests matter were associated with cultural, educational, welfare assistance, at last, intellectuals

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This research, whose theme is related to climacteric, aims to know the social representation of menopause developed by the nurses working for Estratégia Saúde da Família (Family Health Strategy) in João Pessoa PB, as well as identifying its structure and verifying the way it interferes with the assistance and educational practices to the climacterial user. In the theoretical level, it is based on a model that articulates the social representations theory, the central nucleus complementary theory and the central concepts of Pierre Bourdieu s praxiology: habitus, cultural capital, social field and symbolic power. A hundred and forty-seven female nurses who work for Estratégia Saúde da Família (Family Health Strategy) in João Pessoa (PB) took part in this research, and the data collection period was from February 2008 to March 2009. As to the methods and techniques, we used the method to determine the central nucleus based on the free association of words, a questionnaire to identify certain regularities that constitute the nurses habitus, and the semi-structured interview to explore opinions and attitudes when facing assistance situations and educational practices and to collect other relevant information. The data analysis was developed, when referring to the free associations, with the help of the EVOC software, which is a group of articulated programs which carry out the statistical analysis of the evocations and the identification of the possible elements of both the central nucleus and the peripheral system of the social representation. As to the questionnaire, we used the descriptive statistical analysis and the analysis of correlation between the variables. The interviews were submitted to a categorical analysis of the content. The EVOC result indicated that the cognition hormone was the only element of the central nucleus of the social representation of menopause. Due to its symbolic value and structuring power, this central nucleus ensures the strict and, at the same time, flexible character of the representational content. The analysis of the social advancement, of some fundamental features of the group habitus, as well as the analysis of its insertion in the health field and of the attitudinal opinions and dispositions concerning the assistance given to the climacterial user, and the analysis of the pedagogical dimension of this assistance, all these analyses lead to the conclusion that the nurses who took part in this research share a social representation of the menopause resulting from the association of different technical and scientific knowledge. These derive from the biomedical pattern as well as from hegemonic values which disqualify old age and overvalue youth, from pedagogical conceptions arising from patterns that are presently regarded as authoritative and old-fashioned and from cultural references (responsible for the semantic variations concerning the central nucleus) which are specific to the subgroups the nurses belong to. This research enables the creation of opportunities for discussion between active nurses working for Estratégia Saúde da Família, and the nurses who are teachers at institutions of higher education, aiming at linking theory to practice, so that they can find ways of thinking about the climacteric and working, in a more comprehensive way, with users who are experiencing this stage of life

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Plongés dans le temps présent, les dessins humoristiques, par la capacité de représenter, de suggérer et de communiquer une idée, marquent présence à l école et dans la salle de classe. Caractérisés par l utilisation d éléments comiques, satiriques et irôniques, outre la nature persuasive, ces dessins possibilitent le lecteur de faire une lecture critique des événements sociaux et politiques de notre société. En tant que langage visuel, structuré dans les formes verbale et icônique, de même que par le caractère analogique de représentation, les dessins humoristiques constituent un excellent recours pédagogique. Toutefois, ils sont longtemps restés inaperçus par l école et, seul récemment, ils sont devenus objet d investigation de la part des historiens. Dans ce sens, nous nous sommes proposés, dans cette étude, à analyser l utilisation de ces dessins par les professeurs d histoire des écoles publiques nommées Centros Paraibanos de Educação Solidária (CEPES), de João Pessoa, capitale de l Etat de Paraíba, en vue d appréhender et de discuter la façon dont ces professeurs font usage de ces dessins dans leur pratique pédagogique. Par le moyen des actions des professeurs, conçues comme des arts de faire, selon Certeau, et par l identification des usages qui se caractérisent comme des tactiques, nous avons essayé de percevoir comment se réalise le rapport humour et histoire, en salle de classe. La systématisation, la catégorisation et la narration des pratiques pédagogiques observées ont été réalisées par l analyse des questionnaires et des interviews appliqués aux professeurs et élèves, ainsi qu à l observation des classes. Notre recherche s est fondée sur les théories de Roger Chartier et Michel de Certeau, dont les concepts de représentation et d appropriation, d usages et de tactiques nous ont aidé à comprendre la forme par laquelle les sujets incorporés au quotidien de la salle de classe se sont appropriés de la dimension imagétique à travers l humour. A partir des concepts d usage et d appropriation nous avons identifié dans les actions et les parlers, la façon dont les dessins humoristiques sont travaillés par les professeurs. Conçus comme des registres visuels qui relatent des questions sociales, politiques et économiques, ces dessins sont perçus comme des registres visuels qui relatent des questions sociales, politiques et économiques, identifant, ainsi, les adversités du présent, dans le monde social

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Study about the teaching-learning process in History, which intents to point limits and possibilities to this process, starting from its characterization and analysis and understanding of the concepts of history, time, society and culture, used by teachers and students. The field research was performed in the Municipal School of Basic Education Zumbi dos Palmares, located in the city of João Pessoa, Paraíba State, in the period between 1996 and 2006. To achieve the objective of the study, a number of research instruments were used, amongst which, interviews, questionnaires and exercises emphasizing conceptual learning. The theoretical-methodological premises of the qualitative research justify the use of these various instruments, and serve as base for the interpretation and analysis of the data. This study demonstrated that some limits and possibilities that are found in the teaching-learning process in History are originated in the school context of the 1st phase of basic education and remain in the 2nd phase of this education level, partly, because of the understanding that teachers and students have regarding the concepts of history, time, society and culture

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Community Therapy (CT) is in a practice of therapeutic effect and may also be considered as a technology takes care of the therapeutic procedure group, whose purpose is to promote health, prevent illness, developed within primary care in mental health. In this study we sought to understand the social representations of health professionals who work with the Community Therapy, on use of the Family Health Strategy (FHS) in the city of Joao Pessoa. This is a field research with a qualitative view Moscovician Theory of Social Representations, held with seven professionals of the FHS, therapists of Community Health District II. The empirical data were obtained by carrying out two thematic therapies in April 2009, which were wheeled CT. It was used as a technique for analyzing the collective subject discourse, and the data presented through graphs, charts, maps, pictures and graphics and arranged in three stages: Subjects of the study, characterizing the study participants; Social Representations of Therapist Community presenting and discussing the social representations of therapists community studied on CT, and Consequences of Community Therapy at the Family Health Strategy, discussing the meanings attributed by the study participants about changes in FHS. Meanings were attributed to the CT by the therapists studied originated from the speeches, songs, drawings and constructed, and that presented by schematic illustration show the relation between the representations: life, listening, faith / light, change, transformation. The web, symbol of CT, appeared on the images constructed by the representatives of the study and represents the formation of bonds that allows the construction of social support networks that strengthen relationships among community. In the study, proved by professionals who have the meanings about the changes in the work process from the introduction of CT, and shown that the change took place within a more welcoming attitude on the part of professionals, the relationship between Team members had no significant changes, explained by the low compliance of team members to the CT in relation to the user front, the bond was strengthened, and this involved strengthening the role of the therapist community. It is recognized, thereby transforming the character of CT in building links with users, requiring, however, that the team is viewed as offering therapeutic services, not the professional therapist. Therefore, the CT for being a new phenomenon in health services and community belonging, it fits like a novelty which affects the construction of a representation dispute. Still, can contribute to the reorganization of mental health care in line with the new model of mental health care advocated by the Psychiatric Reform.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Communication is seen as vital function. Through it, individuals and organizations relate to each other, the environment and the shares of their own group, influencing each other to turn facts into information. The user of the male part of a group of patients whose health policy is still in development. This fact can create insecurity in the nurse to establish a process that promotes disease prevention, promotion and / or recovery of health for that user. Aiming to elucidate this, the present study aimed to: apprehend the social representations of nurses communication with the users were male, looking for disease prevention, promotion and recovery of his health; identify the factors that influenced, positively or negatively on the effectiveness of nurses communication with the users were male and investigate the strategies used by nurses to clarify communication with the users were male. In order to achieve the goal raised, this study was a descriptive, exploratory and qualitative approach. Was based on theoretical and methodological framework social representations of Denise Jodelet and Serge Moscovici. The project has, through no Parecer nº 649/10, approval of the Ethics and Research HULW. During data collection, we used a semi-structured script and a diary interviews with 24 nurses in basic health units of district-Mangabeira Health District III, the city of João Pessoa (PB). The results were analyzed using the technique of content analysis according to Bardin (2007). Classifying the research subjects and identified three categories and five nuclei of the central ideas. The categories identified: the grasp of the RS communication of nurses with male users, identifying factors that influence the effectiveness of nurses' communication with users and male research on the strategies used by nurses to the elucidation of the communication with male users. The nuclei of the central ideas found: social representations of nurses' communication with the users of the male is externalized as difficult, different, difficult, not technical (knowledge) specific, with a dubious sense in relation to its therapeutic action, the factors examined as positive in this communication were based on the connection between professional and user look in detail and not mechanistic, in preventive actions, the dynamics of care, accessibility, participatory care, humanization, and qualification service. Whereas served as negative factors for the communication, signed on the behavioral differences of men, the feminization of nurses, lack of training for professionals in relation to the subject, prescriptive conduct and prejudice (concerns) sociocultural. Another related consolidated core strategies employed for the occurrence of such communication. Given these results, it was realized the importance of social representations for the consecration of a single language, the common understanding of reality on the nurse's communication with the user in male and determination of changes in the behavior of nurses and the user to the establishment of more effective strategies for obtaining a therapeutic communication between them

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The counseling on HIV/Aids consists in a prevention strategy that contributes to increase the diagnosis of HIV and start earlier the treatment. The counseling has as pillars the emotional and educational support, risks evaluation that aim at the adoption of safe practices and the individual s responsibility for his own health. To accomplish these results, it is necessary that health workers understand counseling as a unique educational moment that stimulates the user s critical-reflection when it comes to his role as an active subject in this process. This study aimed to analyze the counseling on HIV/Aids conducted by the professionals of the Testing and Counseling Center (CTA), based on the educational perspective of Paulo Freire . This is a descriptive qualitative study with a critical reflexive design based on the principles of Action-Science. All the professionals acting as counselors in the Joao Pessoa, PB CTA, eight in total, took part in the study. Data were collected during the month of March, 2011, through non participative observation and semi-structured interviews with a critical-reflexive focus, analyzed according to the tenets of the critical-reflexive methodology, and discussed taking into consideration the Paulo Freire s pedagogy and pertinent literature. It was observed that most of the professionals expressed the work philosophy of CTA as the diagnosis and prevention of the disease, associated with the utilization and demonstration of condoms. However, upon observation of their counseling sessions, these ideas were not converted in actions. Educational themes were not covered and the condom wasn t offered at any time. The counseling actions focused on the provision of information and filling out the paper forms which are necessary for attendance. The sessions were conducted with brief dialogues and little opportunity for the users to expose or complement their thoughts and needs. The professionals mentioned as facilitating conditions for counseling, the team interaction and physical structure. The difficulties focused on the users low cognition, the large demand for attendance, aspects related to the service organization, and the counselors absences and delays. After reflecting about the actions observed in the counseling, the majority of professionals admitted the need to modify their practice in the incorporation of educational principles for the achievement of a broader prevention, and seemed to be willing to work in this perspective. In conclusion, although the counselors show ideas consistent with the purposes of CTA, these ideas are limited when it comes to the understanding of the meaning of prevention in HIV/Aids. Taking into consideration that they express a certain comprehension and act differently during the counseling, they demonstrate a lack of bond between the theories in use and the proposed ones, in accordance with the contribution of the action-science theory. The counseling, as an educative practice, doesn t materialize in the counseling itself and the orientation for reflection is not given during the attendance. These findings suggest the need to include the process of reflection in the execution of the actions of counseling, so that these practices are guided by reflexive practice, aiming at transforming the way of thinking and acting into a more educational perspective toward a more democratic and holistic assistance.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This dissertation has the purpose to present a portable device named PlugData MG100G, equipped with a cellular module, to analyze the radiofrequency coverage in a GSM network situated in João Pessoa city, state of Paraíba, at four distinct regions. The equipment, originally, was developed to be used in fixed environments, so it was adapted so that it could be used in conditions of mobility. From the Mobile Measurement Reports (MMRs) RF coverage and the handover process are analyzed. The MMRs enable the identification of the serving cell and the list of the closest neighboring cells monitored by the mobile. This work analyses only data referent to the serving cell and the two closest neighboring cells. Inter-cell and intra-cell handovers are identified. The frequency planning and quality of service offered by the network related to the regions are discussed as well

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This paper presents an analysis of technical and financial feasibility of the use of a solar system for water heating in a fictitious hotel located in the Northeast region. Thereunto it is used techniques of solar collectors´ sizing and methods of financial mathematics, such as Net Present Value (NPV), Internal Rate of Return (IRR) and Payback. It will also be presented a sensitivity analysis to verify which are the factors that impact the viability of the solar heating. Comparative analysis will be used concerning three cities of distinct regions of Brazil: Curitiba, Belém and João Pessoa. The viability of using a solar heating system will be demonstrated to the whole Brazil, especially to the northeast region as it is the most viable for such an application of solar power because of its high levels of solar radiation. Among the cities examined for a future installation of solar heating systems for water heating in the hotel chain, João Pessoa was the one that has proved more viable.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The current research had as main objective to analyze the possibility of knowledge elaboration/re-elaboration about ideas and algorithmic procedures related to basic operations by pupils of the 6th degree fundamental teaching in a significant learning process. This way the study had as basis a methodological intervention developed in a 6th degree class of a Fundamental Teaching Municipal School in the city of João Pessoa, PB. The research had as central steps the application of pre-tests (1 and 2); the execution of semi-structured interviews with the pupils involved in the theme deep studies; the elaboration and development of teaching activities, having as referential the significant learning and the application of a pre-test. The data collected in the pre-tests (1 and 2) showed a low level of the pupils comprehension about the contents related to the four operations. The answers to the post-test questions were analyzed mainly from the qualitative point of view based on the mathematic concepts comprehension theory proposed by Skemp (1980) having as complementary subsidy data collected through interviews. The analysis of the results obtained in the post-test showed that the major part of pupils reached a relational comprehension about the ideas and algorithmic procedures related to addition, subtraction, multiplication, and division. Such results showed us that the application of a teaching methodology that privileges the content comprehension, considering the pupils previous knowledge and the reflection about the action along the activities proposed, made possible the elaboration or re-elaboration of knowledge by pupils regarding to contents adopted as theme for our research