966 resultados para DSSC Ru(II) tetrazoli fotoassorbitori
Resumo:
A new ECL-active species, Ru (phen)(2) (dcbpy) (PF6)(2), has been designed and synthesized. Its structure was confirmed by means of IR, ESI-MS and 2D NMR. Also, its properties of electrochemistry, fluorescence and ECL are reported, which have suggested a good hope of being used in electrochemiluminescent immunoassay and nucleic acid hybridization.
Resumo:
Novel bifunctional ruthenium(n) complexes, [Ru(TAP)2(POQ-Nmet)]2+ and [Ru(BPY)2(POQ-Nmet)]2+(la, 2a), containing a metallic and an organic moiety, have been prepared as photoprobes and photoreagents of DNA(TAP = 1,4,5,8-tetraazaphenanthrene, POQ-Nmet = 5-[6-(7-chloroquinolin-4-yl)-3-thia-6-azaheptanamido]-l,10phenanthroline). The ES mass spectrometry and 'H NMR data in organic solvents indicate that the quinoline moiety exists in both the protonated and non-protonated form. Moreover, the comparison of the NMR data with those of the corresponding monofunctional complexes(without quinoline) evidences that [Ru(TAP).2(POQ-Nmet)]2+ and [Ru(BPY)J(POQ-Nmet)]2+ are unfolded when the quinoline unit is protonated whereas deprotonation permits folding of the molecule. In the folded state the spatial proximity of the electron donor(the organic moiety) and electron acceptor(the metallic moiety) in [Ru(TAP)2(POQ-Nmet)]2+ favours intramolecular photo-induced electron transfer, which has been shown in a previous study to be responsible for the very low luminescence of la in non-protonating solutions. The restoration of the luminescence by protonation of the quinoline moiety as observed previously is in agreement with the unfolding of the molecule demonstrated in this work. The existence of such folding-unfolding processes related to protonation is crucial for studies of la with DNA. © The Royal Society of Chemistry 2000.
Resumo:
The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.
Resumo:
Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.
Resumo:
A quantitative approach is used to understand the chain growth mechanism in FT synthesis on the Ru, Fe, Rh, and Re surfaces. The C-C coupling reactions are extensively calculated on the stepped metal surfaces. Combining the coupling barriers and reactant stabilities, we investigate the reaction rates of all possible C, + C-1 coupling pathways on the metal surfaces. It is found that (i) all the transition-state structures are similar on these surfaces, while some coupling barriers are very different; (ii) the dominant chain growth pathways on these surfaces are different: C + CH and CH + CH on Rh and Ru surfaces, C + CH3 on Fe surface, and C + CH on Re surface. The common features of the major coupling reactions together with those on the Co surface are also discussed.
Resumo:
The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.
Resumo:
A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.
Resumo:
Tris-chelate 5-hydroxymethyl-2,2 '-bipyridine complexes of ruthenium (II) and the structurally related benzo- and naphthoesters have been isolated. The mer-isomer of the alcohol functionalised complex has been isolated by selective precipitation from methylene chloride and was subsequently functionalised to the benzoester with retention of the geometrical isomerism. The fac- and merisomeric forms of the ester complexes were separated using preparative plate silica chromatography and characterised by H-1 NMR spectroscopy. X-ray structural analysis of the fac-isomer of both the ester complexes confirmed the product assignment. The photophysical properties of the three isomers were investigated, indicating very similar absorption spectra to [Ru(biPY)(3)](2+). The emission wavelength was comparable in each case, with the aromatic ester complexes giving a much longer lifetime and higher quantum yields. (c) 2004 Elsevier B.V. All rights reserved.
Resumo:
The synthesis of three new homoleptic trischelate ruthenium( II) complexes bearing new 2,2'-bipyridine ligands, 5,5'-dibenzylamido-2,2'-bipyridine (L1) and 5-benzylamido-2,2'- bipyridine (L2) has been achieved. In the case of [Ru(L2)(3)](2+), the mer and fac isomers have been separated. H-1 NMR spectroscopic anion binding studies indicate that the two C-3-symmetric pockets provided by [ Ru(L1)(3)](2+) is conducive to receive a range of anions, although this is not readily reflected in the photophysical behaviour. The fac-isomer of [Ru(L2)(3)](2+) does appear to have an enhancement in the binding interactions over the mer form with dihydrogenphosphate salts, although the difference is much less marked with the spherical chloride ions. From X-ray crystallographic evidence, the ability to hold water in the "anion" binding cleft can inhibit the strength of the interactions with anions, giving rise to the observed selectivity for directional oxoanions such as dihydrogen phosphate.
Resumo:
The ruthenium(II) diimine complexes, such as ruthenium(II) tris( bipyridyl), Ru(bpy)(3)(2+), possess highly luminescent excited states that are not only readily quenched by oxygen but also by an increase in temperature. The former effect can be rendered insignificant by encapsulating the complex in an oxygen impermeable polymer, although encapsulation often leads also to a loss of temperature sensitivity. The luminescence properties of Ru(bpy)(3)(2+) encapsulated in PVA were studied as a function of oxygen concentration and temperature and found to be independent of the former, but still very sensitive towards the latter. The results were fitted to an established Arrhenius-type equation, based on thermal quenching of the emitting state by a slightly higher (Delta E = 3100 cm(-1)) (3)d-d state that deactivates very rapidly (10(-13) s) via a non-radiative process.
Resumo:
The kinetics of the oxidation of Ru(bpy)32+ to Ru(bpy)33+ by T13+ ions, catalyzed by a dispersion of RuO2-xH2O in 3 mol dm-3 HNO3, are reported as a function of [Ru(bpy)32+], [Tl3+], [Tl+], [RuO2.xH2O], and temperature. The kinetics of Ru(bpy)32+ oxidation fit an electrochemical model of redox catalysis involving electron transfer between the two electrochemically reversible redox couples, i.e. Ru(bpy)33+/Ru(bpy)32+ and Tl3+/Tl+, mediated by the dispersion of microelectrode particles of RuO2.xH2O. In this model, the rate of reaction is assumed to be controlled by the diffusion of Ru(bpy)32+ toward, and Ru(bpy)33+ away from, the catalyst particles. The Arrhenius activation energy for the catalyzed reaction is 25.9 +/- 0.7 kJ mol-1, and the changes in enthalpy and entropy for the reaction are 36 +/- 2 kJ mol-1 and 127 +/- 6 J mol-1 K-1, respectively. This work describes a rare example of reversible heterogeneous redox catalysis.
Resumo:
Four ruthenium(II) complexes with the formula [Ru(eta(5)-C(5)H(5))(PP)L][CF(3)SO(3)], being (PP = two triphenylphosphine molecules), L = 1-benzylimidazole, 1; (PP = two triphenylphosphine molecules), L = 2,2'bipyridine, 2; (PP = two triphenylphosphine molecules), L = 4-Methylpyridine, 3; (PP = 1,2-bis(diphenylphosphine) ethane), L = 4-Methylpyridine, 4, were prepared, in view to evaluate their potentialities as antitumor agents. The compounds were completely characterized by NMR spectroscopy and their crystal and molecular structures were determined by X-ray diffraction. Electrochemical studies were carried out giving for all the compounds quasi-reversible processes. The images obtained by atomic force microscopy (AFM) suggest interaction with pBR322 plasmid DNA. Measurements of the viscosity of solutions of free DNA and DNA incubated with different concentrations of the compounds confirmed this interaction. The cytotoxicity of compounds 1234 was much higher than that of cisplatin against human leukemia cancer cells (HL-60 cells). IC(50) values for all the compounds are in the range of submicromolar amounts. Apoptotic death percentage was also studied resulting similar than that of cisplatin. (C) 2010 Elsevier Inc. All rights reserved.
Resumo:
The ruthenium(II)-cymene complexes [Ru(eta(6)-cymene)(bha)Cl] with substituted halogenobenzohydroxamato (bha) ligands (substituents = 4-F, 4-Cl, 4-Br, 2,4-F-2, 3,4-F-2, 2,5-F-2, 2,6-F-2) have been synthesized and characterized by elemental analysis, IR, H-1 NMR, C-13 NMR, cyclic voltammetry and controlled-potential electrolysis, and density functional theory (DFT) studies. The compositions of their frontier molecular orbitals (MOs) were established by DFT calculations, and the oxidation and reduction potentials are shown to follow the orders of the estimated vertical ionization potential and electron affinity, respectively. The electrochemical E-L Lever parameter is estimated for the first time for the various bha ligands, which can thus be ordered according to their electron-donor character. All complexes exhibit very strong protein tyrosine kinase (PTK) inhibitory activity, even much higher than that of genistein, the clinically used PTK inhibitory drug. The complex containing the 2,4-difluorobenzohydroxamato ligand is the most active one, and the dependences of the PTK activity of the complexes and of their redox potentials on the ring substituents are discussed. (C) 2012 Elsevier B.V. All rights reserved.