A chemical analysis of five hot stars towards the Galactic centre

High resolution echelle spectroscopy is presented for thirteen stars lying in the direction of the Galactic centre which, on the basis of photographic photometry and low dispersion spectroscopy, have been classified as early-B-type. Eight of these stars have large rotational velocities which preclude a detailed analysis. The five stars with moderate to low projected rotational velocities have been analysed using model atmosphere techniques to determine atmospheric parameters and chemical compositions. Two of these stars appear to be evolved blue horizontal branch objects on the basis of their chemical compositions and small projected rotational velocity. The evolutionary status of a third is ambiguous but it is probably a post-asymptotic-giant branch star. The remaining two objects are probably young massive stars and show enhanced abundances of N, C, Mg and Si, consistent with their formation in the inner part of the Galactic disk. However their O abundances are normal, confirming results found previously for other early- type stars, which would imply a flat abundance gradient for this element in the inner region of our Galaxy.

Strömgren uvby photometry of B-type stars from the Palomar-Green Survey

We present Strömgren uvby photometry for a sample of 31 high Galactic latitude stars selected from the Palomar-Green Survey. The data include photometric magnitudes accurate to

SuperWASP observations of pulsating Am stars

We have studied over 1600 Am stars at a photometric precision of 1 mmag with SuperWASP photometric data. Contrary to previous belief, we find that around 200 Am stars are pulsating d Sct and ? Dor stars, with low amplitudes that have been missed in previous, less extensive studies. While the amplitudes are generally low, the presence of pulsation in Am stars places a strong constraint on atmospheric convection, and may require the pulsation to be laminar. While some pulsating Am stars have been previously found to be d Sct stars, the vast majority of Am stars known to pulsate are presented in this paper. They will form the basis of future statistical studies of pulsation in the presence of atomic diffusion. An extended version of Table 1 containing all the detected frequencies and amplitudes is only available at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/535/A3

The empirical metallicity dependence of the mass-loss rate of O- and early B-type stars

We present a comprehensive study of the observational dependence of the mass-loss rate in stationary stellar winds of hot massive stars on the metal content of their atmospheres. The metal content of stars in the Magellanic Clouds is discussed, and a critical assessment is given of state-of-the-art mass-loss determinations of OB stars in these two satellite systems and the Milky-Way. Assuming a power-law dependence of mass loss on metal content,. M. Z(m), and adopting a theoretical relation between the terminal flow velocity and metal content, v(infinity). Z(0.13) (Leitherer et al. 1992, ApJ, 401, 596), we find m = 0.83 +/- 0.16 for non-clumped outflows from an analysis of the wind momentum luminosity relation (WLR) for stars more luminous than 105.2 L circle dot. Within the errors, this result is in agreement with the prediction m = 0.69 +/- 0.10 by Vink et al. (2001, A& A, 369, 574). Absolute empirical values for the mass loss, based on Ha and ultraviolet (UV) wind lines, are found to be a factor of two higher than predictions in this high luminosity regime. If this difference is attributed to inhomogeneities in the wind, and this clumping does not impact the predictions, this would imply that luminous O and early-B stars have clumping factors in their Ha and UV line forming regions of about a factor of four. For lower luminosity stars, the winds are so weak that their strengths can generally no longer be derived from optical spectral lines (essentially Ha) and one must currently rely on the analysis of UV lines. We confirm that in this low-luminosity domain the observed Galactic WLR is found to be much steeper than expected from theory (although the specific sample is rather small), leading to a discrepancy between UV mass-loss rates and the predictions by a factor 100 at luminosities of L similar to 10(4.75) L circle dot, the origin of which is unknown. We emphasize that even if the current mass-loss rates of hot luminous stars would turn out to be overestimated as a result of wind clumping, but the degree of clumping would be rather independent of metallicity, the scalings derived in this study are expected to remain correct.

Gemini observations of Wolf-Rayet stars in the Local Group starburst galaxy IC 10

We present Gemini-N GMOS and CFHT MOS spectroscopy of Wolf-Rayet candidates in the Local Group dwarf galaxy IC 10 that were previously identified by Massey et al. and Royer et al. From the present spectroscopic survey, the WC/WN ratio for IC 10 remains unusually high, given its low metallicity, although none of the WC9 stars suspected from narrow-band imaging are confirmed. Our spectroscopy confirms 9 newly discovered Wolf-Rayet candidates from Royer et al., whilst spectral types of 14 Wolf-Rayet stars previously observed by Massey & Armandroff are refined here. In total, there are 26 spectroscopically confirmed Wolf-Rayet stars in IC 10. All but one of the fourteen WC stars are WC4-6 stars, the exception being # 10 from Massey et al., a broad-lined, apparently single WC7 star. There are a total of eleven WN stars, which are predominantly early WN3-4 stars, but include a rare WN10 star, # 8 from Royer et al. # 5 from Massey et al. is newly identified as a transition WN/C star. Consequently, the WC/WN ratio for IC10 is 14/11similar to1.3, unusually high for a metal-poor galaxy. Re-evaluating recent photometric data of Massey & Holmes, we suggest that the true WC/WN ratio may not be as low as similar to0.3. Finally, we present ground-based finding charts for all confirmed WR stars, plus HST/WFPC2 charts for twelve cases.

The VLT-FLAMES Tarantula Survey XI. A census of the hot luminous stars and their feedback in 30 Doradus

Context. The VLT-FLAMES Tarantula Survey has an extensive view of the copious number of massive stars in the 30 Doradus (30 Dor) star forming region of the Large Magellanic Cloud. These stars play a crucial role in our understanding of the stellar feedback in more distant, unresolved star forming regions. Aims. The first comprehensive census of hot luminous stars in 30 Dor is compiled within a 10 arcmin (150 pc) radius of its central cluster, R136. We investigate the stellar content and spectroscopic completeness of the early type stars. Estimates were made for both the integrated ionising luminosity and stellar wind luminosity. These values were used to re-assess the star formation rate (SFR) of the region and determine the ionising photon escape fraction. Methods. Stars were selected photometrically and combined with the latest spectral classifications. Spectral types were estimated for stars lacking spectroscopy and corrections were made for binary systems, where possible. Stellar calibrations were applied to obtain their physical parameters and wind properties. Their integrated properties were then compared to global observations from ultraviolet (UV) to far-infrared (FIR) imaging as well as the population synthesis code, Starburst99. Results. Our census identified 1145 candidate hot luminous stars within 150 pc of R136 of which >700 were considered to be genuine early type stars and contribute to feedback. We assess the survey to be spectroscopically complete to 85% in the outer regions (>5 pc) but only 35% complete in the region of the R136 cluster, giving a total of 500 hot luminous stars in the census which had spectroscopy. Only 31 were found to be Wolf-Rayet (W-R) or Of/WN stars, but their contribution to the integrated ionising luminosity and wind luminosity was ~ 40% and ~ 50%, respectively. Similarly, stars with M > 100 M (mostly H-rich WN stars) also showed high contributions to the global feedback, ~ 25% in both cases. Such massive stars are not accounted for by the current Starburst99 code, which was found to underestimate the integrated ionising luminosity of R136 by a factor ~ 2 and the wind luminosity by a factor ~ 9. The census inferred a SFR for 30 Dor of 0.073 ± 0.04 M yr . This was generally higher than that obtained from some popular SFR calibrations but still showed good consistency with the far-UV luminosity tracer as well as the combined Hα and mid-infrared tracer, but only after correcting for Hα extinction. The global ionising output was also found to exceed that measured from the associated gas and dust, suggesting that ~6 % of the ionising photons escape the region. Conclusions. When studying the most luminous star forming regions, it is essential to include their most massive stars if one is to determine a reliable energy budget. Photon leakage becomes more likely after including their large contributions to the ionising output. If 30 Dor is typical of other massive star forming regions, estimates of the SFR will be underpredicted if this escape fraction is not accounted for.

Photodissociation and chemistry of N2 in the circumstellar envelope of carbon-rich AGB stars

The envelopes of AGB stars are irradiated externally by ultraviolet photons; hence, the chemistry is sensitive to the photodissociation of N$_2$ and CO, which are major reservoirs of nitrogen and carbon, respectively. The photodissociation of N$_2$ has recently been quantified by laboratory and theoretical studies. Improvements have also been made for CO photodissociation. For the first time, we use accurate N$_2$ and CO photodissociation rates and shielding functions in a model of the circumstellar envelope of the carbon-rich AGB star, IRC +10216. We use a state-of-the-art chemical model of an AGB envelope, the latest CO and N$_2$ photodissociation data, and a new method for implementing molecular shielding functions in full spherical geometry with isotropic incident radiation. We compare computed column densities and radial distributions of molecules with observations. The transition of N$_2$ $\to$ N (also, CO $\to$ C $\to$ C$^+$) is shifted towards the outer envelope relative to previous models. This leads to different column densities and radial distributions of N-bearing species, especially those species whose formation/destruction processes largely depend on the availability of atomic or molecular nitrogen, for example, C$_n$N ($n$=1, 3, 5), C$_n$N$^-$ ($n$=1, 3, 5), HC$_n$N ($n$=1, 3, 5, 7, 9), H$_2$CN and CH$_2$CN. The chemistry of many species is directly or indirectly affected by the photodissociation of N$_2$ and CO, especially in the outer shell of AGB stars where photodissociation is important. Thus, it is important to include N$_2$ and CO shielding in astrochemical models of AGB envelopes and other irradiated environments. In general, while differences remain between our model of IRC +10216 and the observed molecular column densities, better agreement is found between the calculated and observed radii of peak abundance.

Spitzer Space Telescope spectra of post-AGB stars in the large magellanic Cloud-polycyclic aromatic hydrocarbons at low metallicities

This paper reports variations of polycyclic aromatic hydrocarbons (PAHs) features that were found in Spitzer Space Telescope spectra of carbon-rich post-asymptotic giant branch (post-AGB) stars in the Large Magellanic Cloud (LMC). The paper consists of two parts. The first part describes our Spitzer spectral observing programme of 24 stars including post-AGB candidates. The latter half of this paper presents the analysis of PAH features in 20 carbon-rich post-AGB stars in the LMC, assembled from the Spitzer archive as well as from our own programme.We found that five post-AGB stars showed a broad feature with a peak at 7.7 μm, that had not been classified before. Further, the 10-13 μm PAH spectra were classified into four classes, one of which has three broad peaks at 11.3, 12.3 and 13.3 μm rather than two distinct sharp peaks at 11.3 and 12.7 μm, as commonly found in HII regions. Our studies suggest that PAHs are gradually processed while the central stars evolve from post-AGB phase to planetary nebulae, changing their composition before PAHs are incorporated into the interstellar medium. Although some metallicity dependence of PAH spectra exists, the evolutionary state of an object is more significant than its metallicity in determining the spectral characteristics of PAHs for LMC and Galactic post-AGB stars. © 2014 The Authors Published by Oxford University Press on behalf of the Royal Astronomical Society.

Calibration of time of flight detectors using laser-driven neutron source

Calibration of three scintillators (EJ232Q, BC422Q, and EJ410) in a time-of-flight arrangement using a laser drive-neutron source is presented. The three plastic scintillator detectors were calibrated with gamma insensitive bubble detector spectrometers, which were absolutely calibrated over a wide range of neutron energies ranging from sub-MeV to 20 MeV. A typical set of data obtained simultaneously by the detectors is shown, measuring the neutron spectrum emitted from a petawatt laser irradiated thin foil.

Coronal properties of planet-bearing stars

Context. Do extrasolar planets affect the activity of their host stars? Indications for chromospheric activity enhancement have been found for a handful of targets, but in the X-ray regime, conclusive observational evidence is still missing. Aims: We want to establish a sound observational basis to confirm or reject major effects of Star-Planet Interactions (SPI) in stellar X-ray emissions. Methods: We therefore conduct a statistical analysis of stellar X-ray activity of all known planet-bearing stars within 30 pc distance for dependencies on planetary parameters such as mass and semimajor axis. Results: In our sample, there are no significant correlations of X-ray luminosity or the activity indicator L_X/L_bol with planetary parameters which cannot be explained by selection effects. Conclusions: Coronal SPI seems to be a phenomenon which might only manifest itself as a strong effect for a few individual targets, but not to have a major effect on planet-bearing stars in general.

Indications for an influence of hot Jupiters on the rotation and activity of their host stars

Context. The magnetic activity of planet-hosting stars is an importantfactor for estimating the atmospheric stability of close-in exoplanetsand the age of their host stars. It has long been speculated thatclose-in exoplanets can influence the stellar activity level. However,testing for tidal or magnetic interaction effects in samples ofplanet-hosting stars is difficult because stellar activity hindersexoplanet detection, so that stellar samples with detected exoplanetsshow a bias toward low activity for small exoplanets.

Aims: Weaim to test whether exoplanets in close orbits influence the stellarrotation and magnetic activity of their host stars.

Methods: Wedeveloped a novel approach to test for systematic activity-enhancementsin planet-hosting stars. We use wide (several 100 AU) binary systems inwhich one of the stellar components is known to have an exoplanet, whilethe second stellar component does not have a detected planet andtherefore acts as a negative control. We use the stellar coronal X-rayemission as an observational proxy for magnetic activity and analyzeobservations performed with Chandra and XMM-Newton.

Results: Wefind that in two systems for which strong tidal interaction can beexpected the planet-hosting primary displays a much higher magneticactivity level than the planet-free secondary. In three systems forwhich weaker tidal interaction can be expected the activity levels ofthe two stellar components agree with each other.

Conclusions:Our observations indicate that the presence of Hot Jupiters may inhibitthe spin-down of host stars with thick outer convective layers. Possiblecauses for this effect include a transfer of angular momentum from theplanetary orbit to the stellar rotation through tidal interaction, ordifferences during the early evolution of the system, where the hoststar may decouple from the protoplanetary disk early because of a gapopened by the forming Hot Jupiter.

Isospin-rich nuclei in neutron star matter

Stability of nuclei beyond the drip lines in the presence of an enveloping gas of nucleons and electrons, as prevailing in the inner crust of a neutron star, is studied in the temperature-dependent Thomas-Fermi framework. A limiting asymmetry in the isospin space beyond which nuclei cannot exist emerges from the calculations. The ambient conditions such as temperature, baryon density, and neutrino concentration under which these exotic nuclear systems can be formed are studied in some detail.

Structure of AuCN determined from total neutron diffraction

The structure of gold cyanide, AuCN, has been determined at 10 and 300 K using total neutron diffraction. The structure consists of infinite -Au-(CN)-Au-(CN)-Au-(CN)- linear chains, hexagonally packed, with the gold atoms in sheets. The Au-C and Au-N bond lengths are found to be identical, with d(Au-C/N) = 1.9703(5) Angstrom at 300 K. This work supersedes a previous study, by others, which used Rietveld analysis of neutron Bragg diffraction in isolation, and found these bonds to have significantly different lengths (Deltad = 0.24 Angstrom) at 300 K. The total correlation function, T(r), at 10 and 300 K, has been modeled using information derived from total diffraction. The broadening of inter- and intrachain correlations differs markedly due to random displacements of the chains in the direction of the chain axes. This is a consequence of the relatively weak bonding between the chains. An explanation for the negative thermal expansion in the c-direction, which occurs between 10 and 300 K, is presented.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Three dimensional picture of the local structure of 1,4-Polybutadiene from a complete atomistic model and neutron scattering data

An efficient method of combining neutron diffraction data over an extended Q range with detailed atomistic models is presented. A quantitative and qualitative mapping of the organization of the chain conformation in both glass and liquid phase has been performed. The proposed structural refinement method is based on the exploitation of the intrachain features of the diffraction pattern by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Models are built stochastically by assignment of these internal coordinates from probability distributions with limited variable parameters. Variation of these parameters is used in the construction of models that minimize the differences between the observed and calculated structure factors. A series of neutron scattering data of 1,4-polybutadiene at the region 20320 K is presented. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54 and 1.35 Å respectively. Valence angles of the backbone were found to be at 112 and 122.8 for the CCC and CC=C respectively. Three torsion angles corresponding to the double bond and the adjacent R and β bonds were found to occupy cis and trans, s(, trans and g( and trans states, respectively. We compare our results with theoretical predictions, computer simulations, RIS models, and previously reported experimental results.