Unlocking the technology-mediated learning process : insights and articulating actions for an institutional approach

This paper is part of the results from the project "Implementation Strategies and Development of an Open and Distance Education System for the University of the Azores" funded by the European Social Fund. http://hdl.handle.net/10400.3/2327

Identifying the neural correlates of executive functions in early cerebral microangiopathy: a combined VBM and DTI study.

Cerebral microangiopathy (CMA) has been associated with executive dysfunction and fronto-parietal neural network disruption. Advances in magnetic resonance imaging allow more detailed analyses of gray (e.g., voxel-based morphometry-VBM) and white matter (e.g., diffusion tensor imaging-DTI) than traditional visual rating scales. The current study investigated patients with early CMA and healthy control subjects with all three approaches. Neuropsychological assessment focused on executive functions, the cognitive domain most discussed in CMA. The DTI and age-related white matter changes rating scales revealed convergent results showing widespread white matter changes in early CMA. Correlations were found in frontal and parietal areas exclusively with speeded, but not with speed-corrected executive measures. The VBM analyses showed reduced gray matter in frontal areas. All three approaches confirmed the hypothesized fronto-parietal network disruption in early CMA. Innovative methods (DTI) converged with results from conventional methods (visual rating) while allowing greater spatial and tissue accuracy. They are thus valid additions to the analysis of neural correlates of cognitive dysfunction. We found a clear distinction between speeded and nonspeeded executive measures in relationship to imaging parameters. Cognitive slowing is related to disease severity in early CMA and therefore important for early diagnostics.

Combined clonotyping and gene signatures of individual tumor-reactive CD8 T-cells define their functional relevance following peptide vaccination in melanoma patients

Novel cancer vaccines are capableto efficiently induce and boost humantumor antigen specific T-cells. However,the properties of these CD8T-cells are only partially characterized.For in depth investigation ofT-cells following Melan-A/MART-1peptide vaccination in melanoma patients,we conducted a detailed prospectivestudy at the single cell level.We first sorted individual human naiveand effector CD8 T-cells from peripheralblood by flow cytometry, andtested a modified RT-PCR protocolincluding a global amplification ofexpressed mRNAs to obtain sufficientcDNAfromsingle cells.We successfullydetected the expression ofseveral specific genes of interest evendown to 106-fold dilution (equivalentto 10-5 cell). We then analyzed tumor-specific effector memory (EM)CD8T-cell subpopulations ex vivo, assingle cells from vaccinated melanomapatients. To elucidate the hallmarksof effective immunity the genesignatures were defined by a panel ofgenes related to effector functions(e.g. IFN-, granzyme B, perforin),and individual clonotypes were identifiedaccording to the expression ofdistinct T-cell receptors (TCR). Usingthis novel single cell analysis approach,we observed that T-cell differentiationis clonotype dependent,with a progressive restriction in TCRBV clonotype diversity from EMCD28pos to EMCD28neg subsets. However,the effector function gene imprintingis clonotype-independent,but dependent on differentiation,since it correlates with the subset oforigin (EMCD28pos or EMCD28neg). We also conducted a detailedcomparative analysis after vaccinationwith natural vs. analog Melan-Apeptide. We found that the peptideused for vaccination determines thefunctional outcome of individualT-cell clonotypes, with native peptideinducing more potent effector functions.Yet, selective clonotypic expansionwith differentiation was preservedregardless of the peptide usedfor vaccination. In summary, the exvivo single cell RT-PCR approach ishighly sensitive and efficient, andrepresents a reliable and powerfultool to refine our current view of molecularprocesses taking place duringT-cell differentiation.

Effects of combined electric and acoustic hearing on speech perception of a pediatric cochlear implant user

The primary objective of this study was to document the benefits and possible detriments of combining ipsilateral acoustic hearing in the cochlear implant ear of a patient with preserved low frequency residual hearing post cochlear implantation. The secondary aim was to examine the efficacy of various cochlear implant mapping and hearing aid fitting strategies in relation to electro-acoustic benefits.

Velocities of compressional and shear waves in limestones

Carbonate rocks are important hydrocarbon reservoir rocks with complex textures and petrophysical properties (porosity and permeability) mainly resulting from various diagenetic processes (compaction, dissolution, precipitation, cementation, etc.). These complexities make prediction of reservoir characteristics (e.g. porosity and permeability) from their seismic properties very difficult. To explore the relationship between the seismic, petrophysical and geological properties, ultrasonic compressional- and shear-wave velocity measurements were made under a simulated in situ condition of pressure (50 MPa hydrostatic effective pressure) at frequencies of approximately 0.85 MHz and 0.7 MHz, respectively, using a pulse-echo method. The measurements were made both in vacuum-dry and fully saturated conditions in oolitic limestones of the Great Oolite Formation of southern England. Some of the rocks were fully saturated with oil. The acoustic measurements were supplemented by porosity and permeability measurements, petrological and pore geometry studies of resin-impregnated polished thin sections, X-ray diffraction analyses and scanning electron microscope studies to investigate submicroscopic textures and micropores. It is shown that the compressional- and shear-wave velocities (V-p and V-s, respectively) decrease with increasing porosity and that V-p decreases approximately twice as fast as V-s. The systematic differences in pore structures (e.g. the aspect ratio) of the limestones produce large residuals in the velocity versus porosity relationship. It is demonstrated that the velocity versus porosity relationship can be improved by removing the pore-structure-dependent variations from the residuals. The introduction of water into the pore space decreases the shear moduli of the rocks by about 2 GPa, suggesting that there exists a fluid/matrix interaction at grain contacts, which reduces the rigidity. The predicted Biot-Gassmann velocity values are greater than the measured velocity values due to the rock-fluid interaction. This is not accounted for in the Biot-Gassmann velocity models and velocity dispersion due to a local flow mechanism. The velocities predicted by the Raymer and time-average relationships overestimated the measured velocities even more than the Biot model.

Instability of surface-temperature filaments in strain and shear

The effects of uniform straining and shearing on the stability of a surface quasi-geostrophic temperature filament are investigated. Straining is shown to stabilize perturbations for wide filaments but only for a finite time until the filament thins to a critical width, after which some perturbations can grow. No filament can be stabilized in practice, since there are perturbations that can grow large for any strain rate. The optimally growing perturbations, defined as solutions that reach a certain threshold amplitude first, are found numerically for a wide range of parameter values. The radii of the vortices formed through nonlinear roll-up are found to be proportional to θ/s, where θ is the temperature anomaly of the filament and s the strain rate, and are not dependent on the initial size of the filament. Shearing is shown to reduce the normal-mode growth rates, but it cannot stabilize them completely when there are temperature discontinuities in the basic state; smooth filaments can be stabilized completely by shearing and a simple scaling argument provides the shear rate required. Copyright © 2010 Royal Meteorological Society

Effect of combined heat and high-pressure treatments on the texture of chicken breast muscle (Pectoralis fundus)

Commercially supplied chicken breast muscle was subjected to simultaneous heat and pressure treatments. Treatment conditions ranged from ambient temperature to 70 °C and from 0.1 to 800 MPa, respectively, in various combinations. Texture profile analysis (TPA) of the treated samples was performed to determine changes in muscle hardness. At treatment temperatures up to and including 50 °C, heat and pressure acted synergistically to increase muscle hardness. However, at 60 and 70 °C, hardness decreased following treatments in excess of 200 MPa. TPA was performed on extracted myofibrillar protein gels that after treatment under similar conditions revealed similar effects of heat and pressure. Differential scanning calorimetry analysis of whole muscle samples revealed that at ambient pressure the unfolding of myosin was completed at 60 °C, unlike actin, which completely denatured only above 70 °C. With simultaneous pressure treatment at >200 MPa, myosin and actin unfolded at 20 °C. Unfolding of myosin and actin could be induced in extracted myofibrillar protein with simultaneous treatment at 200 MPa and 40 °C. Electrophoretic analysis indicated high pressure/temperature regimens induced disulfide bonding between myosin chains.

Experimental and theoretical evidence for homogeneous catalysis in the gas-phase reaction of SiH2 with H2O (and D2O): a combined kinetic and quantum chemical study

Time-resolved kinetic studies of the reaction of silylene, SiH2, with H2O and with D2O have been carried out in the gas phase at 297 K and at 345 K, using laser flash photolysis to generate and monitor SiH2. The reaction was studied independently as a function of H2O (or D2O) and SF6 (bath gas) pressures. At a fixed pressure of SF6 (5 Torr), [SiH2] decay constants, k(obs), showed a quadratic dependence on [H2O] or [D2O]. At a fixed pressure of H2O or D2O, k(obs) Values were strongly dependent on [SF6]. The combined rate expression is consistent with a mechanism involving the reversible formation of a vibrationally excited zwitterionic donor-acceptor complex, H2Si...OH2 (or H2Si...OD2). This complex can then either be stabilized by SF6 or it reacts with a further molecule of H2O (or D2O) in the rate-determining step. Isotope effects are in the range 1.0-1.5 and are broadly consistent with this mechanism. The mechanism is further supported by RRKM theory, which shows the association reaction to be close to its third-order region of pressure (SF6) dependence. Ab initio quantum calculations, carried out at the G3 level, support the existence of a hydrated zwitterion H2Si...(OH2)(2), which can rearrange to hydrated silanol, with an energy barrier below the reaction energy threshold. This is the first example of a gas-phase-catalyzed silylene reaction.

Structure, rheology and shear alignment of Pluronic block copolymer mixtures

The structure and flow behaviour of binary mixtures of Pluronic block copolymers P85 and P123 is investigated by small-angle scattering, rheometry and mobility tests. Micelle dimensions are probed by dynamic light scattering. The micelle hydrodynamic radius for the 50/50 mixture is larger than that for either P85 or P123 alone, Clue to the formation of mixed micelles with a higher association number. The phase diagram for 50/50 mixtures contains regions Of Cubic and hexagonal phases similar to those for the parent homopolymers, however the region of stability of the cubic phase is enhanced at low temperature and concentrations above 40 wt%. This is ascribed to favourable packing of the mixed micelles containing core blocks with two different chain lengths, but similar corona chain lengths. The shear flow alignment of face-centred cubic and hexagonal phases is probed by in situ small-angle X-ray or neutron scattering with simultaneous rheology. The hexagonal phase can be aligned using steady shear in a Couette geometry, however the high modulus Cubic phase cannot be aligned well in this way. This requires the application of oscillatory shear or compression. (C) 2008 Elsevier Inc. All rights reserved.

Solid phases of cyclopentane: combined experimental and simulation study

The phase diagram of cyclopentane has been studied by powder neutron diffraction, providing diffraction patterns for phases I, II, and III, over a range of temperatures and pressures. The putative phase IV was not observed. The structure of the ordered phase III has been solved by single-crystal diffraction. Computational modeling reveals that there are many equienergetic ordered structures for cyclopentane within a small energy range. Molecular dynamics simulations reproduce the structures and diffraction patterns for phases I and III and also show an intermediate disordered phase, which is used to interpret phase II.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

The Structure of the chiral Pt{531} surface: a combined LEED and DFT study

The structure of the chiral kinked Pt{531} surface has been determined by low-energy electron diffraction intensity-versus-energy (LEED-IV) analysis and density functional theory (DFT). Large contractions and expansions of the vertical interlayer distances with respect to the bulk-terminated surface geometry were found for the first six layers (LEED: d(12) = 0.44 angstrom, d(23) = 0.69 angstrom, d(34) = 0.49 angstrom, d(45) = 0.95 angstrom, d(56) = 0.56 angstrom; DFT: d(12) = 0.51 angstrom, d(23) = 0.55 angstrom, d(34) = 0.74 angstrom, d(45) = 0.78 angstrom, d(56) = 0.63 angstrom; d(bulk) = 0.66 angstrom). Energy-dependent cancellations of LEED spots over unusually large energy ranges, up to 100 eV, can be explained by surface roughness and reproduced by applying a model involving 0.25 ML of vacancies and adatoms in the scattering calculations. The agreement between the results from LEED and DFT is not as good as in other cases, which could be due to this roughness of the real surface.