993 resultados para Cis-regulatory Sequences


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Die räumliche und zeitliche Organisation von Genexpression ist für die Entwicklung und das Funktionieren eines jeden Lebewesens von immenser Bedeutung. Dazu laufen eine Vielzahl von Regulationsprozessen auf unterschiedlichen Ebenen ab. In dieser Arbeit wurden im ersten Teil Untersuchungen zur Genregulation des Drosophila optomotor-blind Genes und zur Funktion des Omb Proteins durchgeführt. Eine Mutante, der ein großer Teil der upstream regulatory region (URR) fehlt wurde erzeugt, aus einer Vielzahl von Linien isoliert und molekular charakterisiert. Die biologischen Auswirkungen dieser Deletion werden in Shen et al. (2008) beschrieben. Plasmide zur Erzeugung transgener Fliegen, mit deren Hilfe eine bereits von Sivasankaran et al. (2000) durchgeführte Enhancer-reporter-Analyse vervollständigt werden sollte, wurden hergestellt. Die bereits bekannte Inversion In(1)ombH31 wurde molekular kartiert. Eine Reihe von Konstrukten mit Punktmutationen in der Omb T-Domäne wurden generiert, die unter anderem über deren Funktion hinsichtlich DNA-Protein Interaktion und einer potentiellen Metallionenbindefähigkeit (ATCUN) hin Aufschluss geben sollen. Des Weiteren wurde eine Reihe von P-Element-Deletionslinien auf den Verlust eines alternativen omb Transkriptionsstartpunktes hin untersucht, mit dem Ziel eine vollständige Protein-Nullmutante zur Verfügung zu haben. Der zweite Abschnitt dieser Arbeit befasste sich mit der Erzeugung von Dpp-GFP-Fusionskonstrukten, mit deren Hilfe weitere Erkenntnisse über den Dpp-Langstreckentransport erhofft werden. Es wurde außerdem damit begonnen bei einem weitern Drosophila T-Box Transkriptionsfaktor, Optomotor-blind related gene-1 (Org-1), eine Reihe von Varianten mit homopolymeren polyAlanin und polyGlutamin Expansionen unterschiedlicher Länge herzustellen. Durch Experimente mit diesen Konstrukten soll Aufschluss darüber gewonnen werden, ob Glutamin-Expansionen, wie in der Literatur vorgeschlagen, aktivierend und Alanin-Expansionen in Transkriptionsfaktoren vielleicht reprimierend auf Genaktivität wirken. Letztlich wurden in dieser Arbeit im Rahmen des DROSDEL Projektes (Ryder et al., 2004, 2007) Deletionen in der distalen Hälfte des Chromosomenarms 3R hergestellt. Der DROSDEL Deletionskit, der durch eine Kooperation europäischer Labore entstand stellt der Drosophila Forschung einen umfassenden Satz molekular basengenau definierter Defizienzen zur Verfügung.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Expression of the structural genes for the anthrax toxin proteins is coordinately controlled by host-related signals such as elevated CO2 , and the trans-acting positive regulator, AtxA. No specific binding of AtxA to the toxin gene promoters has been demonstrated and no sequence-based similarities are apparent in the promoter regions of toxin genes. We hypothesized that the toxin genes possess common structural features that are required for positive regulation. To test this hypothesis, I performed an extensive characterization of the toxin gene promoters. I determined the minimal sequences required for atxA-mediated toxin gene expression and compared these sequences for structural similarities. In silico modeling and in vitro experiments indicated significant curvature within these regions. Random mutagenesis revealed that point mutations associated with reduced transcriptional activity, mostly mapped to areas of high curvature. This work enabled the identification of two potential cis-acting elements implicated in AtxA-mediated regulation of the toxin genes. In addition to the growth condition requirements and AtxA, toxin gene expression is under growth phase regulation. The transition state regulator AbrB represses atxA expression to influence toxin synthesis. Here I report that toxin gene expression also requires sigH, a gene encoding the RNA polymerase sigma factor associated with development in B. subtilis. In the well-studied B. subtilis system, σH is part of a feedback control pathway that involves AbrB and the major response regulator of sporulation initiation, Spo0A. My data indicate that in B. anthracis, regulatory relationships exist between these developmental regulators and atxA . Interestingly, during growth in toxin-inducing conditions, sigH and abrB expression deviates from that described for B. subtilis, affecting expression of the atxA gene. These findings, combined with previous observations, suggest that the steady state level of atxA expression is critical for optimal toxin gene transcription. I propose a model whereby, under toxin-inducing conditions, control of toxin gene expression is fine-tuned by the independent effects of the developmental regulators on the expression of atxA . The growth condition-dependent changes in expression of these regulators may be crucial for the correct timing and uninterrupted expression of the toxin genes during infection. ^

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Caveolae form the terminus for a major pathway of intracellular free cholesterol (FC) transport. Caveolin mRNA levels in confluent human skin fibroblasts were up-regulated following increased uptake of low density lipoprotein (LDL) FC. The increase induced by FC was not associated with detectable change in mRNA stability, indicating that caveolin mRNA levels were mediated at the level of gene transcription. A total of 924 bp of 5′ flanking region of the caveolin gene were cloned and sequenced. The promoter sequence included three G+C-rich potential sterol regulatory elements (SREs), a CAAT sequence and a Sp1 consensus sequence. Deletional mutagenesis of individual SRE-like sequences indicated that of these two (at −646 and −395 bp) were essential for the increased transcription rates mediated by LDL-FC, whereas the third was inconsequential. Gel shift analysis of protein binding from nuclear extracts to these caveolin promoter DNA sequences, together with DNase I footprinting, confirmed nucleoprotein binding to the SRE-like elements as part of the transcriptional response to LDL-FC. A supershift obtained with antibody to SRE-binding protein 1 (SPEBP-1) indicated that this protein binds at −395 bp. There was no reaction at −395 bp with anti-Sp1 antibody nor with either antibody at −646 bp. The cysteine protease inhibitor N-acetyl-leu-leu-norleucinal (ALLN), which inhibits SREBP catabolism, superinhibited caveolin mRNA levels regardless of LDL-FC. This finding suggests that SREBP inhibits caveolin gene transcription in contrast to its stimulating effect on other promoters. The findings of this study are consistent with the postulated role for caveolin as a regulator of cellular FC homeostasis in quiescent peripheral cells, and the coordinate regulation by SREBP of FC influx and efflux.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Abscisic acid (ABA), a cleavage product of carotenoids, is involved in stress responses in plants. A well known response of plants to water stress is accumulation of ABA, which is caused by de novo synthesis. The limiting step of ABA biosynthesis in plants is presumably the cleavage of 9-cis-epoxycarotenoids, the first committed step of ABA biosynthesis. This step generates the C15 intermediate xanthoxin and C25-apocarotenoids. A cDNA, PvNCED1, was cloned from wilted bean (Phaseolus vulgaris L.) leaves. The 2,398-bp full-length PvNCED1 has an ORF of 615 aa and encodes a 68-kDa protein. The PvNCED1 protein is imported into chloroplasts, where it is associated with the thylakoids. The recombinant protein PvNCED1 catalyzes the cleavage of 9-cis-violaxanthin and 9′-cis-neoxanthin, so that the enzyme is referred to as 9-cis-epoxycarotenoid dioxygenase. When detached bean leaves were water stressed, ABA accumulation was preceded by large increases in PvNCED1 mRNA and protein levels. Conversely, rehydration of stressed leaves caused a rapid decrease in PvNCED1 mRNA, protein, and ABA levels. In bean roots, a similar correlation among PvNCED1 mRNA, protein, and ABA levels was observed. However, the ABA content was much less than in leaves, presumably because of the much smaller carotenoid precursor pool in roots than in leaves. At 7°C, PvNCED1 mRNA and ABA were slowly induced by water stress, but, at 2°C, neither accumulated. The results provide evidence that drought-induced ABA biosynthesis is regulated by the 9-cis-epoxycarotenoid cleavage reaction and that this reaction takes place in the thylakoids, where the carotenoid substrate is located.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

During macronuclear development in the ciliated protozoan Tetrahymena thermophila, extensive DNA deletions occur, eliminating thousands of internal eliminated sequences (IESs). Using an rDNA-based transformation assay we have analyzed the role during DNA deletion of DNA flanking mse2.9, an IES within the second intron of a gene encoding an as yet incompletely characterized protein. We establish that a cis-acting sequence for mse2.9 deletion acts at a distance to specify deletion boundaries. A complex sequence element necessary for efficient and accurate mse2.9 deletion is located in the region 47–81 bp from the right side of mse2.9. The ability of a variety of IES flanking sequences to rescue a processing deficient mse2.9 construct indicates that some cis-acting signal is shared among different IESs. In addition, the short intronic sequence that flanks mse2.9 is able to direct efficient and accurate processing. Despite no obvious sequence similarity between mse2.9 and other IESs, we suggest that a common mechanism is used to delete different families of IESs in Tetrahymena.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Significant differences in levels of copia [Drosophila long terminal repeat (LTR) retrotransposon] expression exist among six species representing the Drosophila melanogaster species complex (D. melanogaster, Drosophila mauritiana, Drosophila simulans, Drosophila sechellia, Drosophila yakuba, and Drosophila erecta) and a more distantly related species (Drosophila willistoni). These differences in expression are correlated with major size variation mapping to putative regulatory regions of the copia 5' LTR and adjacent untranslated leader region (ULR). Sequence analysis indicates that these size variants were derived from a series of regional duplication events. The ability of the copia LTR-ULR size variants to drive expression of a bacterial chloramphenicol acetyltransferase reporter gene was tested in each of the seven species. The results indicate that both element-encoded (cis) and host-genome-encoded (trans) genetic differences are responsible for the variability in copia expression within and between Drosophila species. This finding indicates that models purporting to explain the dynamics and distribution of retrotransposons in natural populations must consider the potential impact of both element-encoded and host-genome-encoded regulatory variation to be valid. We propose that interelement selection among retrotransposons may provide a molecular drive mechanism for the evolution of eukaryotic enhancers which can be subsequently distributed throughout the genome by retrotransposition.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Sterol-regulated transcription of the gene for rat farnesyl diphosphate (FPP) synthase (geranyl-diphosphate:isopentenyl-diphosphate geranyltranstransferase, EC 2.5.1.10) is dependent in part on the binding of the ubiquitous transcription factor NF-Y to a 6-bp element within the proximal promoter. Current studies identify a second element in this promoter that is also required for sterol-regulated transcription in vivo. Mutation of three nucleotides (CAC) within this element blocks the 8-fold induction of FPP synthase promoter-reporter genes that normally occurs when the transfected cells are incubated in medium deprived of sterols. Gel mobility-shift assays demonstrate that the transcriptionally active 68-kDa fragment of the sterol regulatory element (SRE-1)-binding protein assays (SREBP-1) binds to an oligonucleotide containing the wild-type sequence but not to an oligonucleotide in which the CAC has been mutated. DNase 1 protection pattern (footprint) analysis indicates that SREBP-1 binds to nucleotides that include the CAC. Both the in vivo and in vitro assays are affected by mutagenesis of nucleotides adjacent to the CAC. Coexpression of SREBP with a wild-type FPP synthase promoter-reporter gene in CV-1 cells results in very high levels of reporter activity that is sterol-independent. In contrast, the reporter activity remained low when the promoter contained a mutation in the CAC trinucleotide. We conclude that sterol-regulated transcription of FPP synthase is controlled in part by the interaction of SREBP with a binding site that we have termed SRE-3. Identification of this element may prove useful in the identification of other genes that are both regulated by SREBP and involved in lipid biosynthesis.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objectives of the present study were to identify the cis-elements of the promoter absolutely required for the efficient rat NHE3 gene transcription and to locate positive and negative regulatory elements in the 5’-flanking sequence (5’FS), which might modulate the gene expression in proximal tubules, and to compare this result to those reported for intestinal cell lines. We analyzed the promoter activity of different 5’FS segments of the rat NHE3 gene, in the OKP renal proximal tubule cell line by measuring the activity of the reporter gene luciferase. Because the segment spanning the first 157 bp of 5’FS was the most active it was studied in more detail by sequential deletions, point mutations, and gel shift assays. The essential elements for gene transcription are in the region -85 to -33, where we can identify consensual binding sites for Sp1 and EGR-1, which are relevant to NHE3 gene basal transcription. Although a low level of transcription is still possible when the first 25 bp of the 5’FS are used as promoter, efficient transcription only occurs with 44 bp of 5’FS. There are negative regulatory elements in the segments spanning -1196 to -889 and -467 to -152, and positive enhancers between -889 and -479 bp of 5’FS. Transcription factors in the OKP cell nuclear extract efficiently bound to DNA elements of rat NHE3 promoter as demonstrated by gel shift assays, suggesting a high level of similarity between transcription factors of both species, including Sp1 and EGR-1.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Ruthenium compounds in general are well suited for medicinal applications. They have been investigated as immunosuppressants, nitric oxide scavengers, antimicrobial agents, and antimalarials. The aim of this study is to evaluate the immunomodulatory activity of cis-(dichloro) tetraammineruthenium(III) chloride (cis-[RuCl(2)(NH(3))(4)]Cl) on human peripheral blood mononuclear cells (PBMC). The cytotoxic studies performed here revealed that the ruthenium( III) complex presents a cytotoxic activity towards normal human PBMC, only at very high concentration. Results also showed that cis-[ RuCl(2)(NH(3))(4)] Cl presents a dual role on PBMC stimulating proliferation and interleukin-2 (IL-2) production at low concentration and inducing cytotoxicity, inability to proliferate, and inhibiting IL-2 production at high concentration. The noncytotoxic activity of cis-[RuCl(2)(NH(3))(4)] Cl at low concentration towards PBMC, which correlates with the small number of annexin V positive cells and also the absence of DNA fragmentation, suggest that this compound does not induce apoptosis on PBMC. For the first time, we show that, at low concentration (10-100 mu g L(-1)), the cis-[ RuCl(2)(NH(3))(4)] Cl compound induces peripheral blood lymphocytes proliferation and also stimulates them to IL-2 production. These results open a new potential applicability of ruthenium(III) complexes as a possible immune regulatory compound acting as immune suppressor at high concentration and as immune stimulator at low concentration.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Two small RNAs regulate the timing of Caenorhabditis elegans development(1,2). Transition from the first to the second larval stage fates requires the 22-nucleotide lin-4 RNA(1,3,4), and transition from late larval to adult cell fates requires the 21-nucleotide let-7 RNA 2. The lin-4 and let-7 RNA genes are not homologous to each other, but are each complementary to sequences in the 3' untranslated regions of a set of protein-coding target genes that are normally negatively regulated by the RNAs1,2,5,6. Here we have detected let-7 RNAs of similar to 21 nucleotides in samples from a wide range of animal species, including vertebrate, ascidian, hemichordate, mollusc, annelid and arthropod, but not in RNAs from several cnidarian and poriferan species, Saccharomyces cerevisiae, Escherichia coli or Arabidopsis. We did not detect lin-4 RNA in these species. We found that let-7 temporal regulation is also conserved: let-7 RNA expression is first detected at late larval stages in C. elegans and Drosophila, at 48 hours after fertilization in zebrafish, and in adult stages of annelids and molluscs. The let-7 regulatory RNA may control late temporal transitions during development across animal phylogeny.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Gene expression profiling by cDNA microarrays during murine thymus ontogeny has contributed to dissecting the large-scale molecular genetics of T cell maturation. Gene profiling, although useful for characterizing the thymus developmental phases and identifying the differentially expressed genes, does not permit the determination of possible interactions between genes. In order to reconstruct genetic interactions, on RNA level, within thymocyte differentiation, a pair of microarrays containing a total of 1,576 cDNA sequences derived from the IMAGE MTB library was applied on samples of developing thymuses (14-17 days of gestation). The data were analyzed using the GeneNetwork program. Genes that were previously identified as differentially expressed during thymus ontogeny showed their relationships with several other genes. The present method provided the detection of gene nodes coding for proteins implicated in the calcium signaling pathway, such as Prrg2 and Stxbp3, and in protein transport toward the cell membrane, such as Gosr2. The results demonstrate the feasibility of reconstructing networks based on cDNA microarray gene expression determinations, contributing to a clearer understanding of the complex interactions between genes involved in thymus/thymocyte development.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The c fins gene encodes the receptor for macrophage colony-stimulating factor-1. This gene is expressed selectively in the macrophage cell lineage. Previous studies have implicated sequences in intron 2 that control transcript elongation in tissue-specific and regulated expression of c -fms. Four macrophage-specific deoxyribonuclease I (DNase I)-hypersensitive sites (DHSS) were identified within mouse intron 2. Sequences of these DHSS were found to be highly conserved compared with those in the human gene. A 250-bp region we refer to as the fins intronic regulatory element (FIRE), which is even more highly conserved than the c-fins proximal promoter, contains many consensus binding sites for macrophage-expressed transcription factors including Spl, PU.1, and C/EBP. FIRE was found to act as a macrophage-specific enhancer and as a promoter with an antisense orientation preference in transient transfections. In stable transfections of the macrophage line RAW264, as well as in clones selected for high and low-level c -fms mRNA expression, the presence of intron 2 increased the frequency and level of expression of reporter genes compared with those attained using the promoter alone. Removal of FIRE abolished reporter gene expression, revealing a suppressive activity in the remaining intronic sequences. Hence, FIRE is shown to be a key regulatory element in the fins gene.