963 resultados para small nuclear RNA


Relevância:

80.00% 80.00%

Publicador:

Resumo:

The discovery of long non-coding RNA (lncRNA) has dramatically altered our understanding of cancer. Here, we describe a comprehensive analysis of lncRNA alterations at transcriptional, genomic, and epigenetic levels in 5,037 human tumor specimens across 13 cancer types from The Cancer Genome Atlas. Our results suggest that the expression and dysregulation of lncRNAs are highly cancer type specific compared with protein-coding genes. Using the integrative data generated by this analysis, we present a clinically guided small interfering RNA screening strategy and a co-expression analysis approach to identify cancer driver lncRNAs and predict their functions. This provides a resource for investigating lncRNAs in cancer and lays the groundwork for the development of new diagnostics and treatments.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Connective tissue growth factor (CCN2/CTGF) is a matricellular-secreted protein involved in extracellular matrix remodeling. The P19 cell line is an embryonic carcinoma line widely used as a cellular model for differentiation and migration studies. In the present study, we employed an exogenous source of CCN2 and small interference RNA to address the role of CCN2 in the P19 cell aggregation phenomenon. Our data showed that increasing CCN2 protein concentrations from 0.1 to 20 nM decreased the number of cell clusters and dramatically increased cluster size without changing proliferation or cell survival, suggesting that CCN2 induced aggregation. In addition, CCN2 specific silencing inhibited typical P19 cell aggregation, which could be partially rescued by 20 nM CCN2. The present study demonstrates that CCN2 is a key molecule for cell aggregation of embryonic P19 cells.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

To explore how cytohesin-1 (CYTH-1) small interfering RNA (siRNA) influences the insulin-like growth factor receptor (IGFR)-associated signal transduction in prostate cancer, we transfected human prostate cancer PC-3 cell lines with liposome-encapsulatedCYTH-1 siRNA in serum-free medium and exposed the cells to 100 nM IGF-1. The mRNA and protein levels of the signal molecules involved in the IGFR signaling pathways were determined by real-time PCR and detected by Western blotting. The relative mRNA levels of CYTH-1, c-Myc, cyclinD1 and IGF-1R (CYTH-1 siRNA group vs scrambled siRNA group) were 0.26 vs 0.97, 0.34 vs 1.06, 0.10 vs 0.95, and 0.27 vs 0.41 (P < 0.05 for all), respectively. The relative protein levels of CYTH-1, pIGF-1R, pIRS1, pAkt1, pErk1, c-Myc, and cyclinD1 (CYTH-1 siRNA group vsscrambled siRNA group) were 0.10 vs 1.00 (30 min), 0.10 vs 0.98 (30 min), 0.04 vs 0.50 (30 min), 0.10 vs 1.00 (30 min), 0.10 vs 1.00 (30 min), 0.13 vs 0.85 (5 h), and 0.08 vs 0.80 (7 h), respectively. The tyrosine kinase activity of IGF-1R was associated with CYTH-1. The proliferative activity of PC-3 cells transfected with CYTH-1 siRNA was significantly lower than that of cells transfected with scrambled siRNA at 48 h (40.5 vs87.6%, P < 0.05) and at 72 h (34.5 vs 93.5%, P < 0.05). In conclusion, the interference of siRNA with cytohesin-1 leads to reduced IGFR signaling in prostate cancer; therefore, CYTH-1 might serve as a new molecular target for the treatment of prostate cancer.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Neuroblastoma is a solid tumor that occurs mainly in children. Malignant neuroblastomas have a poor prognosis because conventional chemotherapeutic agents are not very effective. Survivin, a member of the inhibitor of the apoptosis protein family, plays a significant role in cell division, inhibition of apoptosis, and promotion of cell proliferation and invasion. Previous studies found that survivin is highly expressed in some malignant neuroblastomas and is correlated with poor prognosis. The aim of this study was to investigate whether survivin could serve as a potential therapeutic target of human neuroblastoma. We employed RNA interference to reduce survivin expression in the human neuroblastoma SH-SY5Y cell line and analyzed the effect of RNA interference on cell proliferation and invasion in vitro and in vivo. RNA interference of survivin led to a significant decrease in invasiveness and proliferation and increased apoptosis in SH-SY5Y cells in vitro. RNA interference of survivin inhibited tumor growth in vivo by 68±13% (P=0.002) and increased the number of apoptotic cells by 9.8±1.2% (P=0.001) compared with negative small interfering RNA (siRNA) treatment controls. Moreover, RNA interference of survivin inhibited the formation of lung metastases by 92% (P=0.002) and reduced microvascular density by 60% (P=0.0003). Survivin siRNA resulted in significant downregulation of survivin mRNA and protein expression both in vitro and in vivo compared with negative siRNA treatment controls. RNA interference of survivin was found to be a potent inhibitor of SH-SY5Y tumor growth and metastasis formation. These results support further clinical development of RNA interference of survivin as a treatment of neuroblastoma and other cancer types.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

p15INK4B, a cyclin-dependent kinase inhibitor, has been recognized as a tumor suppressor. Loss of or methylation of the p15INK4B gene in chronic myeloid leukemia (CML) cells enhances myeloid progenitor formation from common myeloid progenitors. Therefore, we examined the effects of overexpressed p15INK4B on proliferation and apoptosis of CML cells. Overexpression of p15INK4B inhibited the growth of K562 cells by downregulation of cyclin-dependent kinase 4 (CDK4) and cyclin D1 expression. Overexpression of p15INK4B also induced apoptosis of K562 cells by upregulating Bax expression and downregulating Bcl-2 expression. Overexpression of p15INK4B together with STI571 (imatinib) or BCR-ABL1 small interfering RNA (siRNA) also enhanced growth inhibition and apoptosis induction of K562 cells. The enhanced effect was also mediated by reduction of cyclin D1 and CDK4 and regulation of Bax and Bcl-2. In conclusion, our study may provide new insights into the role of p15INK4B in CML and a potential therapeutic target for overcoming tyrosine kinase inhibitor resistance in CML.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

In the last decades, the chemical synthesis of short oligonucleotides has become an important aspect of study due to the discovery of new functions for nucleic acids such as antisense oligonucleotides (ASOs), aptamers, DNAzymes, microRNA (miRNA) and small interfering RNA (siRNA). The applications in modern therapies and fundamental medicine on the treatment of different cancer diseases, viral infections and genetic disorders has established the necessity to develop scalable methods for their cheaper and easier industrial manufacture. While small scale solid-phase oligonucleotide synthesis is the method of choice in the field, various challenges still remain associated with the production of short DNA and RNA-oligomers in very large quantities. On the other hand, solution phase synthesis of oligonucleotides offers a more predictable scaling-up of the synthesis and is amenable to standard industrial manufacture techniques. In the present thesis, various protocols for the synthesis of short DNA and RNA oligomers have been studied on a peracetylated and methylated β-cyclodextrin, and also on a pentaerythritol-derived support. On using the peracetylated and methylated β-cyclodextrin soluble supports, the coupling cycle was simplified by replacement of the typical 5′-O-(4,4′-dimethoxytrityl) protecting group with an acid-labile acetal-protected 5′-O-(1-methoxy-1-methylethyl) group, which upon acid-catalyzed methanolysis released easily removable volatile products. For this reason monomeric building blocks 5′-O-(1-methoxy-1-methylethyl) 3′-(2-cyano-ethyl-N,N-diisopropylphosphoramidite) were synthesized. Alternatively, on using the precipitative pentaerythritol support, novel 2´-O-(2-cyanoethyl)-5´-O-(1-methoxy-1-methylethyl) protected phosphoramidite building blocks for RNA synthesis have been prepared and their applicability by the synthesis of a pentamer was demonstrated. Similarly, a method for the preparation of short RNAs from commercially available 5´-O-(4,4´-dimethoxytrityl)-2´-O-(tert-butyldimethyl-silyl)ribonucleoside 3´-(2-cyanoethyl-N,N-diisopropylphosphoramidite) building blocks has been developed

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Adenoviral vectors are currently the most widely used gene therapeutic vectors, but their inability to integrate into host chromosomal DNA shortened their transgene expression and limited their use in clinical trials. In this project, we initially planned to develop a technique to test the effect of the early region 1 (E1) on adenovirus integration by comparing the integration efficiencies between an E1-deleted adenoviral vector (SubE1) and an Elcontaining vector (SubE3). However, we did not harvest any SubE3 virus, even if we repeated the transfection and successfully rescued the SubE1 virus (2/4 transfections generated viruses) and positive control virus (6/6). The failure of rescuing SubE3 could be caused by the instability of the genomic plasmid pFG173, as it had frequent intemal deletions when we were purifying It. Therefore, we developed techniques to test the effect of E1 on homologous recombination (HR) since literature suggested that adenovirus integration is initiated by HR. We attempted to silence the E1 in 293 cells by transfecting E1A/B-specific small interfering RNA (siRNA). However, no silenced phenotype was observed, even if we varied the concentrations of E1A/B siRNA (from 30 nM to 270 nM) and checked the silencing effects at different time points (48, 72, 96 h). One possible explanation would be that the E1A/B siRNA sequences are not potent enough to Induce the silenced phenotype. For evaluating HR efficiencies, an HR assay system based on bacterial transfonmatJon was designed. We constmcted two plasmids ( designated as pUC19-dl1 and pUC19-dl2) containing different defective lacZa cassettes (forming white colonies after transformation) that can generate a functional lacZa cassette (forming blue colonies) through HR after transfecting into 293 cells. The HR efficiencies would be expressed as the percentages of the blue colonies among all the colonies. Unfortunately, after transfonnation of plasmid isolated from 293 cells, no colony was found, even at a transformation efficiency of 1.8x10^ colonies/pg pUC19, suggesting the sensitivity of this system was low. To enhance the sensitivity, PCR was used. We designed a set of primers that can only amplify the recombinant plasmid fomied through HR. Therefore, the HR efficiencies among different treatments can be evaluated by the amplification results, and this system could be used to test the effect of E1 region on adenovirus integration. In addition, to our knowledge there was no previous studies using PCR/ Realtime PCR to evaluate HR efficiency, so this system also provides a PCR-based method to carry out the HR assays.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

In this study, an efficient methodology for the preparation of carbohydrate-RNA conjugates was established, which involved the use of 3,4~diethoxy-3-cyclobutene-l,2- dione (diethyl squarate) as the linking reagent. First, a glycan moiety containing an amino group reacted with diethyl squarate to form an activated glycan, which further reacted with an amino modified oligoribonucleotide to form a glycoconjugate under slightly basic conditions. The effect of glycosylation on the stability of RNA molecules was evaluated on two glycoconjugates, monomannosyl UlO-mer and dimannosyl UlO-mer. In the synthesis of aromatic fluorescent ribosides, perbenzylated ribofuranosyl pyrene and phenanthrene were synthesized from perbenzylated ribolactone. Deprotection of benzyl-protected ribofuranosyl phenanthrene and pyrene by boron tribromide gave ribofuranosyl phenanthrene and ribopyranosyl pyrene, respectively. UV/vis and fluorescent properties of the ribosides were characterized.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Les protéines sont les macromolécules les plus polyvalentes de la cellule. Elles jouent un rôle fondamental dans la majorité des processus biologiques à travers la formation de complexes multi-protéiques. Durant la transcription, une multitude de facteurs sont impliquées dans le contrôle de l’activité des complexes ARN polymérases. Notre laboratoire s’est intéressé au réseau d’interaction de la machinerie de transcription des ARN polymérases nucléaires, dans le but de mieux comprendre leurs mécanismes de régulation. Pour ce faire, une procédure protéomique comprenant la purification de complexes protéiques par affinité couplée à la spectrométrie de masse et à l’analyse bioinformatique a été développée. La méthode de purification TAP (Tandem Affinity Purification) a été adaptée pour permettre la purification de complexes protéiques solubles assemblés in vivo à partir de cellules humaines. L’objectif de mon projet de maîtrise était de purifier le complexe de l’ARN Pol I ainsi que de poursuivre l’expansion du réseau d’interactions protéine-protéine de la machinerie de transcription de l’ARN Pol II humaine. À l’aide des protéines POLR1E, TWISTNB, POLR2E, PFDN4, MBD2, XPA, CAND1 et PDCD5 étiquetées (TAP-tag) exprimées dans des lignées cellulaires ECR-293, plusieurs complexes protéiques solubles ont été purifiés et analysés par spectrométrie de masse. Les interactions protéiques ont été triées et validées bioinformatiquement pour donner en final une liste d’interactions ayant un haut degré de confiance à partir de laquelle des réseaux d’interactions protéine-protéine ont été créés. Le réseau créé au cours de ce projet connecte plusieurs composantes de la machinerie transcriptionnelle tels que les ARN Pol I, II et III, les complexes RPAP3/R2TP/prefoldin-like, TRiC/CCT, Mi-2/NuRD et des facteurs de transcription et de réparation de l’ADN. Ce type d’analyse nous a permis d’identifier et de caractériser de nouveaux régulateurs de la machinerie de transcription de l’ARN Pol I et II et de mieux comprendre son fonctionnement.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Quelques évidences suggèrent que Bcl-xL, un membre anti-apoptotique de la famille Bcl-2, possède également des fonctions au niveau du cycle cellulaire et de ses points-contrôle. Pour étudier la régulation et fonction de Bcl-xL au cours du cycle cellulaire, nous avons généré et exprimé dans des cellules humaines une série de mutants de phosphorylation incluant Thr41Ala, Ser43Ala, Thr47Ala, Ser49Ala, Ser56Ala, Ser62Ala et Thr115Ala. L'analyse de cette série de mutants révèle que les cellules exprimant Bcl-xL(Ser62Ala) sont moins stables au point-contrôle G2 du cycle cellulaire comparées aux cellules exprimant le type sauvage ou les autres mutants de phosphorylation incluant Thr41Ala, Ser43Ala, Thr47Ala, Ser56Ala et Thr115Ala. Les études de cinétiques de phosphorylation et de localisation de phospho-Bcl-xL(Ser62) dans des cellules synchronisées et suite à l'activation du point-contrôle en G2 médié par l'étoposide (VP16), nous indiquent que phospho-Bcl-xL(Ser62) migre dans les corps nucléolaires durant l'arrêt en G2 dans les cellules exposées au VP16. Une série d'expériences incluant des essais kinase in vitro, l'utilisation d'inhibiteurs pharmacologiques et d'ARN interférant, nous révèlent que Polo kinase 1 (PLK1) et MAPK9/JNK2 sont les protéines kinase impliquées dans la phosphorylation de Bcl-xL(Ser62), et pour son accumulation dans les corps nucléolaires pendant le point-contrôle en G2. Nos résultats indiquent que durant le point-contrôle en G2, phospho-Bcl-xL(Ser62) se lie et se co-localise avec CDK1(CDC2), le complexe cycline-kinase qui contrôle l'entrée en mitose. Nos résultats suggèrent que dans les corps nucléolaires, phospho-Bcl-xL(Ser62) stabilise l'arrêt en G2 en séquestrant CDK1(CDC2) pour retarder l'entrée en mitose. Ces résultats soulignent également que les dommages à l'ADN influencent la composition des corps nucléolaires, structure nucléaire qui émerge maintenant comme une composante importante de la réponse aux dommages à l'ADN. Dans une deuxième étude, nous décrivons que les cellules exprimant le mutant de phosphorylation Bcl-xL(Ser62Ala) sont également plus stables au point-contrôle de l'assemblage du fuseau de la chromatine (SAC) suite à une exposition au taxol, comparées aux cellules exprimant le type sauvage ou d'autres mutants de phosphorylation de Bcl-xL, incluant Thr41Ala, Ser43Ala, Thr47Ala, Ser56Ala. Cet effet est indépendent de la fonction anti-apoptotique de Bcl-xL. Bcl-xL(Ser62) est fortement phosphorylé par PLK1 et MAPK14/SAPKp38α à la prométaphase, la métaphase et à la frontière de l'anaphase, et déphosphorylé à la télophase et la cytokinèse. Phospho-Bcl-xL(Ser62) se trouve dans les centrosomes avec γ-tubuline, le long du fuseau mitotique avec la protéine moteure dynéine et dans le cytosol mitotique avec des composantes du SAC. Dans des cellules exposées au taxol, phospho-Bcl-xL(Ser62) se lie au complexe inhibiteur CDC20/MAD2/BUBR1/BUB3, alors que le mutant Bcl-xL(Ser62Ala) ne se lie pas à ce complexe. Ces résultats indiquent que durant le SAC, la phosphorylation de Bcl-xL(Ser62) accélère la résolution du SAC et l'entrée des cellules en anaphase. Des expériences bloquant l'expression de Bcl-xL révèlent ègalement un taux très élevé de cellules tétraploïdes et binuclées après un traitement au nocodazole, consistant avec une fonction de Bcl-xL durant la mitose et dans la stabilité génomique. Dans la troisième étude, l'analyse fonctionnelle de cette série de mutants de phosphorylation indique également que les cellules exprimant Bcl-xL(Ser49Ala) sont moins stables durant le point-contrôle G2 et entre en cytokinèse plus lentement dans des cellules exposées aux inhibiteurs de la polymérisation/dépolymérisation des tubulines, composantes des microtubules. Ces effets de Bcl-xL(Ser49Ala) sont indépendents de sa fonction anti-apoptotique. La phosphorylation de Bcl-xL(Ser49) est dynamique au cours du cycle cellulaire. Dans des cellules synchronisées, Bcl-xL(Ser49) est phosphorylé en phase S et G2, déphosphorylé à la prométaphase, la métaphase et à la frontière de l'anaphase, et re-phosphorylé durant la télophase et la cytokinèse. Au cours du point-contrôle G2 induit par les dommages à l'ADN, un pool important de phospho-Bcl-xL(Ser49) se trouve aux centrosomes, un site important pour la régulation de l'entrée en mitose. Durant la télophase et la cytokinèse, phospho-Bcl-xL(Ser49) se trouve le long des microtubules avec la protéine moteure dynéine et dans le cytosol mitotique. Finalement, nos résultats suggèrent que PLK3 est responsable de la phosphorylation de Bcl-xL(Ser49), une protéine kinase impliquée pour l'entrée des cellules en mitose et pour la progression de la mitose jusqu'à la division cellulaire.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Les virus exploitent la machinerie cellulaire de l’hôte de façon très variée et plusieurs types vont même jusqu’à incorporer certaines protéines cellulaires. Nous avons récemment effectué la première analyse protéomique du virion mature de l’Herpès simplex de type 1 (HSV-1), ce qui nous a permis de déterminer que jusqu’à 49 protéines cellulaires différentes se retrouvaient dans ce virus (Loret, S. et al. (2008). "Comprehensive characterization of extracellular herpes simplex virus type 1 virions." J Virol 82(17): 8605-18.). Afin de déterminer leur importance dans le cycle de réplication d’HSV-1, nous avons mis au point un système de criblage nous permettant de quantifier le virus produit et relâché dans le milieu extracellulaire en utilisant un virus marqué à la GFP ainsi que des petits ARN interférents (pARNi) ciblant spécifiquement ces protéines cellulaires. Cette approche nous a permis de démontrer que 17 des protéines identifiées précédemment jouaient un rôle critique dans la réplication d’HSV-1, suggérant ainsi que leur incorporation dans le virus n’est pas aléatoire. Nous avons ensuite examiné le rôle d’une de ces protéines, DDX3X (DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked), une protéine multifonctionnelle connue pour son implication dans les cycles de réplication de plusieurs virus humains. À l’aide de pARNi ainsi que de différentes lignées cellulaires, dont une lignée DDX3X thermosensible, nous avons démontré que l’inhibition de DDX3X résultait en une diminution du nombre de capsides intracellulaires et induisait une importante diminution de l’expression des gènes viraux. Nous avons aussi démontré que la fraction de DDX3X incorporée dans le virion contribuait activement au cycle infectieux d’HSV-1. Ces résultats confirment l’intérêt de notre approche afin d’étudier les interactions hôte-pathogène en plus de démontrer la contribution des protéines cellulaires incorporées à HSV-1 dans l’infection virale.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Mémoire numérisé par la Division de la gestion de documents et des archives de l'Université de Montréal.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Objectif : Étudier les mécanismes apoptotiques impliqués dans la néphropathie diabétique en identifiant les gènes responsables de l’apoptose et activés par les espèces réactives de l’oxygène (ROS) dans les cellules de tubules proximaux rénaux (RPTC) de différents modèles diabétiques. Méthodes : Une hybridation par puce à AND a été réalisée sur les ARN extraits à partir de RPTC de souris heterozygotes db/m+, db/db and db/db catalase (CAT)-transgénique (Tg) de 20 semaines. Des expériences de PCR en temps réel et d’immunohistochimie réalisées sur ces modèles et sur le modèle ou le diabète avait été induit par traitement au streptozotocin (STZ) ont permis de valider les gènes apoptotiques identifiés par puce à ADN. Des RPTC immortalisées de rat ont été utilisées pour montrer l’activité de ces gènes apoptotique et la régulation de leur expression. De plus, une étude additionnelle réalisée sur des sections rénales provenant de patients diabétiques et non diabétiques a démontré également une surexpression de ces gènes apoptotiques dans les IRPTC. Résultats: L’expression de Bcl-2-modifying factor (Bmf), une protéine apoptotique, semble augmentée dans les RPTC de souris db/db comparé aux souris contrôles db/m+, ou aux souris db/db CAT-tg. La surexpression de Bmf a également été identifiée dans les RPTC du modèle diabétique STZ. La normalisation de l’hyperglycémie chez ces souris par traitement à l’insuline semble normaliser également l’expression de Bmf. In vitro, la surexpression du cDNA de Bmf dans les RPTC promouvoit l’apoptose et augmente l’activité de caspase 3. La stimulation de RPTC de Rat avec le glucose élevé (25mM de D-glucose) semble augmenter l’expression de Bmf et le traitement de ces cellules avec la roténone, les Diphénylène iodonium, la catalase et l’apocynine semble renverser cette stimulation. L’inhibition de Bmf avec un siRNA semble réduire l’apoptose induite par le glucose élevé. L’expression de Bmf a également été démontrée dans les RPTC de patients diabétiques. Conclusion: Ces résultats ont démontré une surexpression de Bmf dans les RPTC de différents modèles diabétiques et suggèrent son potentiel rôle dans la régulation de l’apoptose et de l’atrophie tubulaire chez les diabétiques.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Viral protein U (Vpu) is an accessory protein of HIV‐1 that efficiently targets BST2/Tetherin, a cellular restriction factor that acts as molecular anchor impeding the release of various enveloped viruses from the cell surface. The recently discovered natural receptor of BST2 is ILT7, a molecule exclusively expressed at the surface of the professional type 1 interferon (IFN‐1) producing cells, plasmacytoid dendritic cells (pDCs). The interaction between BST2 and ILT7 has been reported to efficiently induce a repression of IFN­‐1 secretion by pDCs. Here, we investigated the impact of Vpu mediated antagonism of BST2, in regards to this newly described immune function of BST2. Using a system of CD4+ T cell lines infected with wild type or Vpu‐deficient HIV-­1 cultured with peripheral blood mononuclear cells or purified pDCs, we report that the presence of Vpu efficiently reduces IFN-­1 production from sensing pDCs. Furthermore, we observed that this Vpu effect is dependent on the availability of BST2 molecules at the surface of the infected cells, since the Vpu's immunoregulation is abrogated when blocking any potential BST2 trans interaction with anti­‐BST2 antibodies. Similarly, depleting ILT7 from pDCs by means of small interfering RNA treatment equally negates the downregulation of pDC IFN-­1 secretion by Vpu. Finally, the use of recombinant soluble ILT7 competes with pDC‐bound ILT7 for the free BST2 and similarly results in high IFN-­1 production, causing an identical phenotype. Overall, our results demonstrate that Vpu heightens ILT7 activation and subsequent repression of IFN‐1 production by pDCs in response to HIV­‐1 infected CD4+ T cells by promoting it's trans interaction with infected T cell bound BST2, through a yet uncharacterized mechanism. By allowing efficient particle release and restraining pDCs antiviral functions, Vpu exerts a double role on BST2 that seems crucial for the replication and dissemination of HIV‐1.