875 resultados para ruthenium arene
Resumo:
[GRAPHICS]
Resumo:
This thesis is concerned with an investigation of the anodic behaviour of ruthenium and iridium in aqueous solution and particularly of oxygen evolution on these metals. The latter process is of major interest in the large-scale production of hydrogen gas by the electrolysis of water. The presence of low levels of ruthenium trichloride ca. 10-4 mol dm-3 in acid solution give a considerable increase in the rate of oxygen evolution from platinum and gold, but not graphite, anodes. The mechanism of this catalytic effect was investigated using potential step and a.c. impedance technique. Earlier suggestions that the effect is due to catalysis by metal ions in solution were proved to be incorrect and it was shown that ruthenium species were incorporated into the surface oxide film. Changes in the oxidation state of these ruthenium species is probably responsible for the lowering of the oxygen overvoltage. Both the theoretical and practical aspects of the reaction were complicated by the fact that at constant potential the rates of both the catalysed and the uncatalysed oxygen evolution processes exhibit an appreciable, continuous decrease with either time or degree of oxidation of the substrate. The anodic behaviour of iridium in the oxide layer region has been investigated using conventional electrochemical techniques such as cyclic voltammetry. Applying a triangular voltage sweep at 10 Hz, 0.01 to 1.50V increases the amount of electric charge which the surface can store in the oxide region. This activation effect and the mechanism of charge storage is discussed in terms of both an expanded lattice theory for oxide growth on noble metals and a more recent theory of irreversible oxide formation with subsequent stoichiometry changes. The lack of hysteresis between the anodic and cathodic peaks at ca. 0.9 V suggests that the process involved here is proton migration in a relatively thick surface layer, i.e. that the reaction involved is some type of oxide-hydroxide transition. Lack of chloride ion inhibition in the anodic region also supports the irreversible oxide formation theory; however, to account for the hydrogen region of the potential sweep a compromise theory involving partial reduction of the outer regions of iridium oxide film is proposed. The loss of charge storage capacity when the activated iridium surface is anodized for a short time above ca. 1.60 V is attributed to loss by corrosion of the outer active layer from the metal surface. The behaviour of iridium at higher anodic potentials in acid solution was investigated. Current-time curves at constant potential and Tafel plots suggested that a change in the mechanism of the oxygen evolution reaction occurs at ca. 1.8 V. Above this potential, corrosion of the metal occurred, giving rise to an absorbance in the visible spectrum of the electrolyte (λ max = 455 nm). It is suggested that the species involved was Ir(O2)2+. A similar investigation in the case of alkaline electrolyte gave no evidence for a change in mechanism at 1.8 V and corrosion of the iridium was not observed. Oxygen evolution overpotentials were much lower for iridium than for platinum in both acidic and alkaline solutions.
Resumo:
The tris[tetrachlorobenzenediolato]phosphate(v) anion (TRISPHAT) is known to be an efficient NMR chiral shift agent for various chiral cationic species. Here we compare the efficiency of TRISPHAT and of a chiral lanthanide shift reagent for the determination of the enantiomeric purity of the chiral building block [Ru(phen)[2]PY[2]][2][+] which possesses C[2] symmetry. We also discuss our results in terms of the geometry of interaction between the Ru(II) complex and the TRISPHAT anion.
Resumo:
Novel bifunctional ruthenium(n) complexes, [Ru(TAP)2(POQ-Nmet)]2+ and [Ru(BPY)2(POQ-Nmet)]2+(la, 2a), containing a metallic and an organic moiety, have been prepared as photoprobes and photoreagents of DNA(TAP = 1,4,5,8-tetraazaphenanthrene, POQ-Nmet = 5-[6-(7-chloroquinolin-4-yl)-3-thia-6-azaheptanamido]-l,10phenanthroline). The ES mass spectrometry and 'H NMR data in organic solvents indicate that the quinoline moiety exists in both the protonated and non-protonated form. Moreover, the comparison of the NMR data with those of the corresponding monofunctional complexes(without quinoline) evidences that [Ru(TAP).2(POQ-Nmet)]2+ and [Ru(BPY)J(POQ-Nmet)]2+ are unfolded when the quinoline unit is protonated whereas deprotonation permits folding of the molecule. In the folded state the spatial proximity of the electron donor(the organic moiety) and electron acceptor(the metallic moiety) in [Ru(TAP)2(POQ-Nmet)]2+ favours intramolecular photo-induced electron transfer, which has been shown in a previous study to be responsible for the very low luminescence of la in non-protonating solutions. The restoration of the luminescence by protonation of the quinoline moiety as observed previously is in agreement with the unfolding of the molecule demonstrated in this work. The existence of such folding-unfolding processes related to protonation is crucial for studies of la with DNA. © The Royal Society of Chemistry 2000.
Resumo:
The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.
Resumo:
Fac-ruthenium(II) tris-(5-carboxy-2,2'-bipyridine) has been synthesised as a single geometric isomer for the first time, and proves to be a good "building-block" to introduce new functionality with retention of the isomeric integrity.
Resumo:
Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.