Studio della trasduzione del Segnale Nucleare Inositide-Dipendente: identificazione di eEF1A2 come nuovo Fosfosubstrato di PKC βI

Introduction Phospholipase Cb1 (PLC-β1) is a key player in the regulation of nuclear inositol lipid signaling and of a wide range of cellular functions, such as proliferation and differentiation (1,2,3). PLCb1 signaling depends on the cleavage of phosphatidylinositol 4,5-bisphosphate and the formation of the second messengers diacylglycerol and Inositol tris-phosphate which activate canonical protein kinase C (cPKC) isoforms. Here we describe a proteomic approach to find out a potential effector of nuclear PLC-b1 dependent signaling during insulin stimulated myogenic differentiation. Methods Nuclear lysates obtained from insulin induced C2C12 myoblasts were immunoprecipitated with anti-phospho-substrate cPKC antibody. Proteins, stained with Comassie blue, were excised, digested and subsequently analysed in LC-MS/MS. For peptide sequence searching, the mass spectra were processed and analyzed using the Mascot MS/MS ion search program with the NCBI database. Western blotting, GST-pull down and co-immunoprecipitation were performed to study the interaction between eEF1A2 and cPKCs. Site direct mutagenesis was performed to confirm the phosphorylated motif recognized by the antibody. Immunofluorescence analysis, GFP-tagged eEF1A2 vector and subcellular fractionation were performed to study nuclear localization and relative distribution of eEF1A2. Results We have previously shown that PLC-β1 is greatly increased at the nuclear level during insulin-induced myoblasts differentiation and that this nuclear localization is essential for induction of differentiation. Thus, nuclear proteins of insulin stimulated C2C12 myoblasts, were immunoprecipitated with an anti-phospho-substrate cPKC antibody. After Electrophoretic gel separation of proteins immunoprecipitated, several molecules were identified by LC-MS/MS. Among these most relevant and unexpected was eukaryotic elongation factor 1 alpha 2 (eEF1A2). We found that eEF1A2 is phosphorylated by PKCb1 and that these two molecules coimmunolocalized at the nucleolar level. eEF1A2 could be phosphorylated in many sites among which both threonine and serine residues. By site direct mutagenesis we demonstrated that it is the serine residue of the motif recognized by the antibody that is specifically phosphorylated by PKCb1. The silencing of PLCb1 gives rise to a reduction of expression and phosphorylation levels of eEF1A2 indicating this molecule as a target of nuclear PLCb1 regulatory network during myoblasts differentiation.

Genetic Manipulation, Gene Silencing and Biomarker Development in Multiple Experimental Models.

The thesis is set in three different parts, according to the relative experimental models. First, the domestic pig (Sus scrofa) is part of the study on reproductive biotechnologies: the transgenesis technique of Sperm Mediated Gene Transfer is widely studied starting from the quality of the semen, through the study of multiple uptakes of exogenous DNA and lastly used in the production of multi-transgenic blastocysts. Finally we managed to couple the transgenesis pipeline with sperm sorting and therefore produced transgenic embryos of predetermined sex. In the second part of the thesis the attention is on the fruit fly (Drosophila melanogaster) and on its derived cell line: the S2 cells. The in vitro and in vivo models are used to develop and validate an efficient way to knock down the myc gene. First an efficient in vitro protocol is described, than we demonstrate how the decrease in myc transcript remarkably affects the ribosome biogenesis through the study of Polysome gradients, rRNA content and qPCR. In vivo we identified two optimal drivers for the conditional silencing of myc, once the flies are fed with RU486: the first one is throughout the whole body (Tubulin), while the second is a head fat body driver (S32). With these results we present a very efficient model to study the role of myc in multiple aspects of translation. In the third and last part, the focus is on human derived lung fibroblasts (hLF-1), mouse tail fibroblasts and mouse tissues. We developed an efficient assay to quantify the total protein content of the nucleus on a single cell level via fluorescence. We coupled the protocol with classical immunofluorescence so to have at the same time general and particular information, demonstrating that during senescence nuclear proteins increase by 1.8 fold either in human cells, mouse cells and mouse tissues.

A reduced model clarifies the role of feedback loops and time delays in the Drosophila circadian oscillator.

Although several detailed models of molecular processes essential for circadian oscillations have been developed, their complexity makes intuitive understanding of the oscillation mechanism difficult. The goal of the present study was to reduce a previously developed, detailed model to a minimal representation of the transcriptional regulation essential for circadian rhythmicity in Drosophila. The reduced model contains only two differential equations, each with time delays. A negative feedback loop is included, in which PER protein represses per transcription by binding the dCLOCK transcription factor. A positive feedback loop is also included, in which dCLOCK indirectly enhances its own formation. The model simulated circadian oscillations, light entrainment, and a phase-response curve with qualitative similarities to experiment. Time delays were found to be essential for simulation of circadian oscillations with this model. To examine the robustness of the simplified model to fluctuations in molecule numbers, a stochastic variant was constructed. Robust circadian oscillations and entrainment to light pulses were simulated with fewer than 80 molecules of each gene product present on average. Circadian oscillations persisted when the positive feedback loop was removed. Moreover, elimination of positive feedback did not decrease the robustness of oscillations to stochastic fluctuations or to variations in parameter values. Such reduced models can aid understanding of the oscillation mechanisms in Drosophila and in other organisms in which feedback regulation of transcription may play an important role.

ANKRD1, the gene encoding cardiac ankyrin repeat protein, is a novel dilated cardiomyopathy gene.

OBJECTIVES: We evaluated ankyrin repeat domain 1 (ANKRD1), the gene encoding cardiac ankyrin repeat protein (CARP), as a novel candidate gene for dilated cardiomyopathy (DCM) through mutation analysis of a cohort of familial or idiopathic DCM patients, based on the hypothesis that inherited dysfunction of mechanical stretch-based signaling is present in a subset of DCM patients. BACKGROUND: CARP, a transcription coinhibitor, is a member of the titin-N2A mechanosensory complex and translocates to the nucleus in response to stretch. It is up-regulated in cardiac failure and hypertrophy and represses expression of sarcomeric proteins. Its overexpression results in contractile dysfunction. METHODS: In all, 208 DCM patients were screened for mutations/variants in the coding region of ANKRD1 using polymerase chain reaction, denaturing high-performance liquid chromatography, and direct deoxyribonucleic acid sequencing. In vitro functional analyses of the mutation were performed using yeast 2-hybrid assays and investigating the effect on stretch-mediated gene expression in myoblastoid cell lines using quantitative real-time reverse transcription-polymerase chain reaction. RESULTS: Three missense heterozygous ANKRD1 mutations (P105S, V107L, and M184I) were identified in 4 DCM patients. The M184I mutation results in loss of CARP binding with Talin 1 and FHL2, and the P105S mutation in loss of Talin 1 binding. Intracellular localization of mutant CARP proteins is not altered. The mutations result in differential stretch-induced gene expression compared with wild-type CARP. CONCLUSIONS: ANKRD1 is a novel DCM gene, with mutations present in 1.9% of DCM patients. The ANKRD1 mutations may cause DCM as a result of disruption of the normal cardiac stretch-based signaling.

Cyan fluorescent protein expression in ganglion and amacrine cells in a thy1-CFP transgenic mouse retina.

PURPOSE: To characterize cyan fluorescent protein (CFP) expression in the retina of the thy1-CFP (B6.Cg-Tg(Thy1-CFP)23Jrs/J) transgenic mouse line. METHODS: CFP expression was characterized using morphometric methods and immunohistochemistry with antibodies to neurofilament light (NF-L), neuronal nuclei (NeuN), POU-domain protein (Brn3a) and calretinin, which immunolabel ganglion cells, and syntaxin 1 (HPC-1), glutamate decarboxylase 67 (GAD(67)), GABA plasma membrane transporter-1 (GAT-1), and choline acetyltransferase (ChAT), which immunolabel amacrine cells. RESULTS: CFP was extensively expressed in the inner retina, primarily in the inner plexiform layer (IPL), ganglion cell layer (GCL), nerve fiber layer, and optic nerve. CFP fluorescent cell bodies were in all retinal regions and their processes ramified in all laminae of the IPL. Some small, weakly CFP fluorescent somata were in the inner nuclear layer (INL). CFP-containing somata in the GCL ranged from 6 to 20 microm in diameter, and they had a density of 2636+/-347 cells/mm2 at 1.5 mm from the optic nerve head. Immunohistochemical studies demonstrated colocalization of CFP with the ganglion cell markers NF-L, NeuN, Brn3a, and calretinin. Immunohistochemistry with antibodies to HPC-1, GAD(67), GAT-1, and ChAT indicated that the small, weakly fluorescent CFP cells in the INL and GCL were cholinergic amacrine cells. CONCLUSIONS: The total number and density of CFP-fluorescent cells in the GCL were within the range of previous estimates of the total number of ganglion cells in the C57BL/6J line. Together these findings suggest that most ganglion cells in the thy1-CFP mouse line 23 express CFP. In conclusion, the thy1-CFP mouse line is highly useful for studies requiring the identification of ganglion cells.

Aldosterone-induced Sgk1 relieves Dot1a-Af9-mediated transcriptional repression of epithelial Na+ channel alpha.

Aldosterone plays a major role in the regulation of salt balance and the pathophysiology of cardiovascular and renal diseases. Many aldosterone-regulated genes--including that encoding the epithelial Na+ channel (ENaC), a key arbiter of Na+ transport in the kidney and other epithelia--have been identified, but the mechanisms by which the hormone modifies chromatin structure and thus transcription remain unknown. We previously described the basal repression of ENaCalpha by a complex containing the histone H3 Lys79 methyltransferase disruptor of telomeric silencing alternative splice variant a (Dot1a) and the putative transcription factor ALL1-fused gene from chromosome 9 (Af9) as well as the release of this repression by aldosterone treatment. Here we provide evidence from renal collecting duct cells and serum- and glucocorticoid-induced kinase-1 (Sgk1) WT and knockout mice that Sgk1 phosphorylated Af9, thereby impairing the Dot1a-Af9 interaction and leading to targeted histone H3 Lys79 hypomethylation at the ENaCalpha promoter and derepression of ENaCalpha transcription. Thus, Af9 is a physiologic target of Sgk1, and Sgk1 negatively regulates the Dot1a-Af9 repressor complex that controls transcription of ENaCalpha and likely other aldosterone-induced genes.

Computational identification and functional validation of regulatory motifs in cartilage-expressed genes.

Chondrocyte gene regulation is important for the generation and maintenance of cartilage tissues. Several regulatory factors have been identified that play a role in chondrogenesis, including the positive transacting factors of the SOX family such as SOX9, SOX5, and SOX6, as well as negative transacting factors such as C/EBP and delta EF1. However, a complete understanding of the intricate regulatory network that governs the tissue-specific expression of cartilage genes is not yet available. We have taken a computational approach to identify cis-regulatory, transcription factor (TF) binding motifs in a set of cartilage characteristic genes to better define the transcriptional regulatory networks that regulate chondrogenesis. Our computational methods have identified several TFs, whose binding profiles are available in the TRANSFAC database, as important to chondrogenesis. In addition, a cartilage-specific SOX-binding profile was constructed and used to identify both known, and novel, functional paired SOX-binding motifs in chondrocyte genes. Using DNA pattern-recognition algorithms, we have also identified cis-regulatory elements for unknown TFs. We have validated our computational predictions through mutational analyses in cell transfection experiments. One novel regulatory motif, N1, found at high frequency in the COL2A1 promoter, was found to bind to chondrocyte nuclear proteins. Mutational analyses suggest that this motif binds a repressive factor that regulates basal levels of the COL2A1 promoter.

Wingless activity in the precursor cells specifies neuronal migratory behavior in the Drosophila nerve cord.

Neurons and their precursor cells are formed in different regions within the developing CNS, but they migrate and occupy very specific sites in the mature CNS. The ultimate position of neurons is crucial for establishing proper synaptic connectivity in the brain. In Drosophila, despite its extensive use as a model system to study neurogenesis, we know almost nothing about neuronal migration or its regulation. In this paper, I show that one of the most studied neuronal pairs in the Drosophila nerve cord, RP2/sib, has a complicated migratory route. Based on my studies on Wingless (Wg) signaling, I report that the neuronal migratory pattern is determined at the precursor cell stage level. The results show that Wg activity in the precursor neuroectodermal and neuroblast levels specify neuronal migratory pattern two divisions later, thus, well ahead of the actual migratory event. Moreover, at least two downstream genes, Cut and Zfh1, are involved in this process but their role is at the downstream neuronal level. The functional importance of normal neuronal migration and the requirement of Wg signaling for the process are indicated by the finding that mislocated RP2 neurons in embryos mutant for Wg-signaling fail to properly send out their axon projection.

Analysis of a human placental lactogen gene promoter

Human placental lactogen (hPL) and human growth hormone (hGH) comprise a multigene family that share $>$90% nucleic acid sequence homology including 500 bp of 5$\sp\prime$ flanking sequence. Despite these similarities, hGH is produced in the anterior pituitary while hPL is expressed in the placenta. For most genes studied to date, regulation of expression occurs by alterations at the level of transcriptional initiation. Nuclear proteins bind specific DNA sequences in the promoter to regulate gene expression. In this study, the hPL$\sb3$ promoter was analyzed for DNA sequences that contribute to its expression. The interaction between the hPL$\sb3$ promoter and nuclear proteins was examined using nuclear extracts from placental and non-placental cells.^ To identify regulatory elements in the promoter of the hPL$\sb3$ gene, 5$\sp\prime$ deletion mutants were constructed by cleaving 1200 bp of upstream sequence with various restriction enzymes. These DNA fragments were ligated 5$\sp\prime$ to a promoterless bacterial gene chloramphenicol acetyltransferase (CAT) and transfected into JEG-3 cells, a human placental choriocarcinoma cell line. The level of CAT activity reflects the ability of the promoter mutants to activate transcription. Deletion of the sequence between $-$142 bp and $-$129 bp, relative to the start of transcription, resulted in an 8-fold decrease in CAT activity. Nuclear proteins from JEG-3, HeLa, and HepG2 (human liver cells), formed specific binding complexes with this region of the hPL$\sb3$ promoter, as shown by gel mobility shift assay. The $-$142 bp to $-$129 bp region contains a sequence similar to that of a variant binding site for the transcription factor Sp1. Sp1-like proteins were identified by DNA binding assay, in the nuclear extracts of the three cell lines. A series of G nucleotides in the hPL$\sb3$ promoter regulatory region were identified by methylation interference assay to interact with the DNA-binding proteins and the pattern obtained is similar to that for other Sp1 binding sites that have been studied. This suggests that hPL$\sb3$ may be transcriptionally regulated by Sp1 or a Sp1-like transacting factor. ^

Transcriptional regulation of the invariant chain associated with MHC class II molecules

The invariant chain associated with the major histocompatibility complex (MHC) class II molecules is a non-polymorphic glycoprotein implicated in antigen processing and class II molecule intracellular transport. Class II molecules and invariant chain (In) are expressed primarily by B lymphocytes and antigen-presenting cells such as macrophages and can be induced by interferon gamma (IFN-$\gamma$) in a variety of cell types such as endothelial cells, fibroblasts, and astrocytes. In this study the cis-acting sequences involved in the constitutive, tissue-specific, and IFN-$\gamma$ induced expression of the human In gene were investigated and nuclear proteins which specifically bound these sequences were identified.^ To define promoter sequences involved in the regulation of the human In gene, 790 bp 5$\sp\prime$ to the initiation of transcription were subcloned upstream of the gene encoding chloramphenicol acetyl transferase (CAT). Transfection of this construct into In expressing and non-expressing cell lines demonstrated that this 790 bp In promoter sequence conferred tissue specificity to the CAT gene. Deletion mutants were created in the promoter to identify sequences important for transcription. Three regulatory regions were identified $-$396 to $-$241, $-$241 to $-$216, and $-$216 to $-$165 bp 5$\sp\prime$ to the cap site. Transfection into a human glioblastoma cell line, U-373 MG, and treatment with IFN-$\gamma$, demonstrated that this 5$\sp\prime$ region is responsive to IFN-$\gamma$. An IFN-$\gamma$ response element was sublocalized to the region $-$120 to $-$61 bp. This region contains homology to the interferon-stimulated response element (ISRE) identified in other IFN responsive genes. IFN-$\gamma$ induces a sequence-specific DNA binding factor which binds to an oligonucleotide corresponding to $-$107 to $-$79 bp of the In promoter. This factor also binds to an oligonucleotide corresponding to $-$91 to $-$62 of the interferon-$\beta$ gene promoter, suggesting this factor may be member of the IRF-1/ISGF2, IRF-2, ICSBP family of ISRE binding proteins. A transcriptional enhancer was identified in the first intron of the In gene. This element, located in a 2.6 kb BamHI/PstI fragment, enhances the IFN-$\gamma$ response of the promoter in U-373 MG. The majority of the In enhancer activity was sublocalized to a 550 bp region $\sim$1.6 kb downstream of the In transcriptional start site. ^

The effect of v-{\it mos\/} expression on the regulation of the {\it fos\/} promoter in 490N3T cells

The v-mos oncogene acquired by Moloney murine sarcoma viruses by recombination with the c-mos proto-oncogene encodes a 37kD cytoplasmic serine/threonine protein kinase which can phosphorylate tubulin and vimentin, as well as the cyclin B component of the maturation promotion factor complex (MPF). Our earliest experiments asked whether the v-mos protein could activate the transcription of transin. Since the transcription of transin was known to be mediated by both fos-dependent and fos-independent pathways, it seemed possible that the induction of transin transcription by v-mos might be mediated by p55$\sp{\rm c-}\sp{fos}$. Surprisingly, when we examined the effect of v-mos on the fos promoter, we observed a significant inhibition of transcription in 49ON3T cells, a subclone of N1H3T3 mouse fibroblasts.^ In this thesis we show that in mouse 49ON3T cells, transcription from the fos promoter is up to 10-fold repressed in the presence of v-mos. Moreover, in this cell line several other transforming constructs (v-ras, v-src, neu) also cause repression of the fos promoter. Interestingly, nontransforming oncogenes (e.g. myc) do not repress fos transcription. The repressive effect was lost in v-mos mutants lacking in ATP-binding or kinase domain, arguing that the effect on fos transcription was mediated by v-mos transforming kinase activity. As mos is a cytoplasmic protein, it was assumed that transcriptional repression was mediated by conversion of a transcriptional regulator to a repressor by mos-induced phosphorylation. As a first approximation of the identity of this factor, we mapped the position of the mos effect on the fos promoter using reporter (CAT) constructs. We found that repression was mediated by regions $-$221 to $-$106 and $-$122 to $-$65 relative to the fos transcriptional start site, both of which regions regulate baseline fos transcription. There are direct repeats containing E2F transcriptional activator/repressor recognition motifs in these regions which bind similar nuclear proteins independently of v-mos presence or absence. Our data show that the contribution of the direct repeat to baseline fos transcription is mediated by these E2F sites with perhaps some contribution from the overlapping retinoblastoma control element (RCE). We have shown that there is a separate DNA protein interaction in the direct repeat which is more pronounced in the presence of v-mos. The recognition site for this protein, which we speculate mediates the mos-induced downregulation of fos transcription, overlaps but is distinct from the E2F and RCE binding sites. (Abstract shortened by UMI.) ^

Molecular mechanisms of chondrocyte-specific expression on the mouse pro$\alpha$1(II) collagen gene

Type II collagen is a major chondrocyte-specific component of the cartilage extracellular matrix and it represents a typical differentiation marker of mature chondrocytes. In order to delineate cis-acting elements of the mouse pro$\alpha1$(II) collagen gene that control chondrocyte-specific expression in intact mouse embryos, we generated transgenic mice harboring chimeric constructions in which varying lengths of the promoter and intron 1 sequences were linked to a $\beta$-galactosidase reporter gene. A construction containing a 3000-bp promoter and a 3020-bp intron 1 fragment directed high levels of $\beta$-galactosidase expression specifically to chondrocytes. Successive deletions of intron 1 delineated a 48-bp fragment which targeted $\beta$-galactosidase expression to chondrocytes with the same specificity as the larger intron 1 fragment. When the Col2a1 promoter was replaced with a minimal $\beta$-globin promoter, the 48-bp intron 1 sequence was still able to target expression of the transgene to chondrocytes, specifically. Therefore a 48-bp intron 1 DNA segment of the mouse Col2a1 gene contains the necessary information to confer high-level, temporally correct, chondrocyte expression to a reporter gene in intact mouse embryos and that Col2a1 promoter sequences are dispensable for chondrocyte expression. Nuclear proteins present selectively in mouse primary chondrocytes and rat chondrosarcoma cells bind to the three putative HMG (High-Mobility-Group) domain protein binding sites in this 48-bp sequence and the chondrocyte-specific proteins likely bind the DNA through minor groove. Together, my results indicate that a 48-bp sequence in Col2a1 intron 1 controls chondrocyte-specific expression in vivo and suggest that chondrocytes contain specific nuclear proteins involved in enhancer activity. ^

The effects of DNA cytosine methylation on H -ras promoter structure and function

The effect of DNA cytosine methylation on H-ras promoter activity was assessed using a transient expression system employing the plasmid H-rasCAT (NaeI H-ras promoter linked to the chloramphenicol acetyltransferase (CAT) gene). This 551 bp promoter is 80% GC rich, enriched with 168 CpG dinucleotides, and contains six functional GC box elements which represent major DNA methylation target sites. Prokaryotic methyltransferases HhaI (CGm$\sp5$CG) and HpaII (Cm$\sp5$CGG) alone or in combination with a human placental methyltransferase (HP MTase) were used to introduce methyl groups at different CpG sites within the promoter. To test for functional promoter activity, the methylated plasmids were introduced into CV-1 cells and CAT activity assessed 48 h post-transfection. Methylation at specific HhaI and HpaII sites reduced CAT expression by 70%, whereas more extensive methylation at generalized CpG sites with HP MTase inactivated the promoter $>$95%. The inhibition of H-ras promoter activity was not attributable to methylation-induced differences in DNA uptake or stability in the cell, topological form of the plasmid, or methylation effects in nonpromoter regions. We also observed that DNA cytosine methylation of a 360 bp promoter fragment by HP MTase induced a local change in DNA conformation. Using three independent methodologies (nitrocellulose filter binding assays, gel mobility shifts, and Southwestern blots), we determined that this change in promoter conformation affected the interaction of nuclear proteins with cis-regulatory sequences residing in the promoter region. The results provide evidence to suggest that DNA methylation may regulate gene expression by inducing changes in local promoter conformation which in turn alters the interactions between DNA and protein factors required for transcription. The results provide supportive evidence for the hypothesis of Cedar and Riggs, who postulated that DNA methylation may regulate gene expression by altering the binding affinities of proteins for DNA. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Characterization of tomato Cycling Dof Factors reveals conserved and new functions in the control of flowering time and abiotic stress responses.

DNA binding with One Finger (DOF) transcription factors are involved in multiple aspects of plant growth and development but their precise roles in abiotic stress tolerance are largely unknown. Here we report a group of five tomato DOF genes, homologous to Arabidopsis Cycling DOF Factors (CDFs), that function as transcriptional regulators involved in responses to drought and salt stress and flowering-time control in a gene-specific manner. SlCDF1?5 are nuclear proteins that display specific binding with different affinities to canonical DNA target sequences and present diverse transcriptional activation capacities in vivo. SlCDF1?5 genes exhibited distinct diurnal expression patterns and were differentially induced in response to osmotic, salt, heat, and low-temperature stresses. Arabidopsis plants overexpressing SlCDF1 or SlCDF3 showed increased drought and salt tolerance. In addition, the expression of various stress-responsive genes, such as COR15, RD29A, and RD10, were differentially activated in the overexpressing lines. Interestingly, overexpression in Arabidopsis of SlCDF3 but not SlCDF1 promotes late flowering through modulation of the expression of flowering control genes such as CO and FT. Overall, our data connect SlCDFs to undescribed functions related to abiotic stress tolerance and flowering time through the regulation of specific target genes and an increase in particular metabolites