Neuropeptide Y, substance P, and human bone morphogenetic protein 2 stimulate human osteoblast osteogenic activity by enhancing gap junction intercellular communication

Bone homeostasis seems to be controlled by delicate and subtle “cross talk” between the nervous system and “osteo-neuromediators” that control bone remodeling. The purpose of this study was to evaluate the effect of interactions between neuropeptides and human bone morphogenetic protein 2 (hBMP2) on human osteoblasts. We also investigated the effects of neuropeptides and hBMP2 on gap junction intercellular communication (GJIC). Osteoblasts were treated with neuropeptide Y (NPY), substance P (SP), or hBMP2 at three concentrations. At various intervals after treatment, cell viability was measured by the MTT assay. In addition, cellular alkaline phosphatase (ALP) activity and osteocalcin were determined by colorimetric assay and radioimmunoassay, respectively. The effects of NPY, SP and hBMP on GJIC were determined by laser scanning confocal microscopy. The viability of cells treated with neuropeptides and hBMP2 increased significantly in a time-dependent manner, but was inversely associated with the concentration of the treatments. ALP activity and osteocalcin were both reduced in osteoblasts exposed to the combination of neuropeptides and hBMP2. The GJIC of osteoblasts was significantly increased by the neuropeptides and hBMP2. These results suggest that osteoblast activity is increased by neuropeptides and hBMP2 through increased GJIC. Identification of the GJIC-mediated signal transduction capable of modulating the cellular activities of bone cells represents a novel approach to studying the biology of skeletal innervation.

B cells expressing IL-10 mRNA modulate memory T cells after DNA-Hsp65 immunization

In DNA vaccines, the gene of interest is cloned into a bacterial plasmid that is engineered to induce protein production for long periods in eukaryotic cells. Previous research has shown that the intramuscular immunization of BALB/c mice with a naked plasmid DNA fragment encoding the Mycobacterium leprae 65-kDa heat-shock protein (pcDNA3-Hsp65) induces protection against M. tuberculosis challenge. A key stage in the protective immune response after immunization is the generation of memory T cells. Previously, we have shown that B cells capture plasmid DNA-Hsp65 and thereby modulate the formation of CD8+ memory T cells after M. tuberculosis challenge in mice. Therefore, clarifying how B cells act as part of the protective immune response after DNA immunization is important for the development of more-effective vaccines. The aim of this study was to investigate the mechanisms by which B cells modulate memory T cells after DNA-Hsp65 immunization. C57BL/6 and BKO mice were injected three times, at 15-day intervals, with 100 µg naked pcDNA-Hsp65 per mouse. Thirty days after immunization, the percentages of effector memory T (TEM) cells (CD4+ and CD8+/CD44high/CD62Llow) and memory CD8+ T cells (CD8+/CD44high/CD62Llow/CD127+) were measured with flow cytometry. Interferon γ, interleukin 12 (IL-12), and IL-10 mRNAs were also quantified in whole spleen cells and purified B cells (CD43−) with real-time qPCR. Our data suggest that a B-cell subpopulation expressing IL-10 downregulated proinflammatory cytokine expression in the spleen, increasing the survival of CD4+ TEM cells and CD8+ TEM/CD127+ cells.

Natural born weight gainers: The mechanisms of obesity in transgenic mice overexpressing neuropeptide Y

Neuropeptide Y (NPY) is a neurotransmitter promoting energy storage by activating Y-receptors and thus affecting food intake, thermogenesis and adipose tissue metabolism. NPY is expressed both in the central and sympathetic nervous system. Hypothalamic NPY is known to stimulate feeding, but the effects of noradrenergic neuron NPY are more ambiguous. Chronic stress stimulates fat accumulation via NPY release from noradrenergic neurons. Furthermore, polymorphism in the human Npy gene has been associated with metabolic disturbances and increased NPY secretion after sympathetic stimulation. The main objective of this study was to clarify the mechanisms of noradrenergic neuron NPY in the development of obesity. The metabolic phenotype of a homozygous mouse overexpressing NPY in the brain noradrenergic neurons and sympathetic nervous system (OE-NPYDβH mouse) was characterized. OE-NPYDβH mice had an increased fat mass and body weight, which caused impairments of glucose metabolism and hyperinsulinaemia with age. There were no differences in energy intake or expenditure, but the sympathetic tone was down-regulated and the endocannabinoid system activated. Furthermore, peripheral Y2-receptors in energy-rich conditions played an important role in mediating the fat-accumulating effect of NPY. These results indicate that noradrenergic neuron NPY promotes obesity via direct effects in the periphery and by modulating the sympatho-adrenal and endocannabinoid systems. Additionally, NPY in the central noradrenergic neurons is believed to possess many important roles. The phenotype of the OE-NPYDβH mouse resembles the situations of chronic stress and Npy gene polymorphism and thus these mice may be exploited in testing novel drug candidates for the treatment of obesity.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

The role of cyclic nucleotides in modulation of crayfish neuromuscular junctions by a neuropeptide /

DF2, a heptapeptide, is a member of the family of FMRFamide-like peptides and has been shown to increase the amount of transmitter released at neuromuscular junctions of the crayfish, Procambarus clarkit Recent evidence has shown that protein kinase C (PKC), calcium/calmodulin-dependent protein kinase II (CaMKII) and the cAMPdependent protein kinase (PKA) play a role in the neuromodulatory pathway of DF2. The involvement of these kinases led to the prediction that a G-protein-coupled receptor (GPCR) is activated by DF2 due to the role that each kinase plays in traditional GPCR pathways seen in other organisms and in other cells. G-proteins can also act on an enzyme that generates cyclic guanosine monophosphate (cGMP) which mediates its effects through a cGMP-dependent protein kinase (PKG). This thesis addresses the question of whether or not DF2's effects on synaptic transmission in crayfish are mediated by the cyclic nucleotides cAMP and cGMP. The effects of DF2 on synaptic transmission were examined using deep abdominal extensor muscles of the crayfish Procambarus clarkii. An identified motor neuron was stimulated, and excitatory post-synaptic potentials (EPSPs) were recorded in abdominal extensor muscle LI . A number of activators and inhibitors were used to determine whether or not cAMP, PKA, cGMP and PKG mediate the effect of this peptide. Chemicals that are known to activate PKA (Sp-cAMPS) and/or PKG (8-pCPTcGMP) mimic and potentiate DF2's effect by increasing EPSP amplitude. Inhibitors of either PKA (Rp-cAMPS) or PKG (Rp-8-pCPT-cGMPS) block a portion of the increase in EPSP amplitude induced by the peptide. When both kinase inhibitors are applied simultaneously, the entire effect of DF2 on EPSPs is blocked. The PKG inhibitor blocks the effects of a PKG activator but does not alter the effect of a PKA activator on EPSP amplitude. Thus, the PKG inhibitor appears to be relatively specific for PKG. A trend in the data suggests that the PKA inhibitor blocks a portion of the response elicited by the PKG activator. Thus, the PKA inhibitor may be less specific for PKA. Phosphodiesterase inhibitors, which are known to inhibit the breakdown of cAMP (IBMX) and/or cGMP (mdBAMQ), potentiate the effect of the peptide. These results support the hypothesis that cAMP and cGMP, acting through their respective protein kinase enzymes, mediate the ability of DFi to increase transmitter output.

Isolation of DNA sequences with homology to a degenerate FaRP oligonucleotide from the crayfish Procambarus clarkii

The neuropeptide Th1RFamide with the sequence Phe-Met-Arg-Phe-amide was originally isolated in the clam Macrocallista nimbosa (price and Greenberg, 1977). Since its discovery, a large family ofFl\1RFamide-related peptides termed FaRPs have been found to be present in all major animal phyla with functions ranging from modulation of neuronal activity to alteration of muscular contractions. However, little is known about the genetics encoding these peptides, especially in invertebrates. As FaRP-encoding genes have yet to be investigated in the invertebrate Malacostracean subphylum, the isolation and characterization ofFaRP-encoding DNA and mRNA was pursued in this project. The immediate aims of this thesis were: (1) to amplify mRNA sequences of Procambarus clarkii using a degenerate oligonucleotide primer deduced from the common amino acid sequence ofisolated Procambarus FaRPS, (2) to determine if these amplification products encode FaRP gene sequences, and (3) to create a selective cDNA library of sequences recognized by the degenerate oligonucleotide primer. The polymerase chain reaction - rapid amplification of cDNA ends (PCR-RACE) is a procedure in which a single gene-specific primer is used in conjunction with a generalized 3' or 5' primer to amplify copies ofthe region between a single point in the transcript and the 3' or 5' end of cDNA of interest (Frohman et aI., 1988). PCRRACE reactions were optimized with respect to primers used, buffer composition, cycle number, nature ofgenetic substrate to be amplified, annealing, extension and denaturation temperatures and times, and use of reamplification procedures. Amplification products were cloned into plasmid vectors and recombinant products were isolated, as were the recombinant plaques formed in the selective cDNA library. Labeled amplification products were hybridized to recombinant bacteriophage to determine ligated amplification product presence. When sequenced, the five isolated PCR-RACE amplification products were determined not to possess FaRP-encoding sequences. The 200bp, 450bp, and 1500bp sequences showed homology to the Caenorhabditis elegans cosmid K09A11, which encodes for cytochrome P450; transfer-RNA; transposase; and tRNA-Tyr, while the 500bp and 750bp sequences showed homology with the complete genome of the Vaccinia virus. Under the employed amplification conditions the degenerate oligonucleotide primer was observed to bind to and to amplify sequences with either 9 or 10bp of 17bp identity. The selective cDNA library was obselVed to be of extremely low titre. When library titre was increased, white. plaques were isolated. Amplification analysis of eight isolated Agt11 sequences from these plaques indicated an absence of an insertion sequence. The degenerate 17 base oligonucleotide primer synthesized from the common amino acid sequence ofisolated Procambarus FaRPs was thus determined to be non-specific in its binding under the conditions required for its use, and to be insufficient for the isolation and identification ofFaRP-encoding sequences. A more specific primer oflonger sequence, lower degeneracy, and higher melting temperature (TJ is recommended for further investigation into the FaRP-encoding genes of Procambarlls clarkii.

A Survey of hMLH1 mRNA Splicing Profiles in Human Cell Lines: Comparing Primary Cultured Fibroblasts Before and After Oxidative Stress and Transiently versus Stably Demethylated Colon Cancer Derived Cell Lines

Most human genes undergo alternative splicing and loss of splicing fidelity is associated with disease. Epigenetic silencing of hMLH 1 via promoter cytosine methylation is causally linked to a subset of sporadic non-polyposis colon cancer and is reversible by 5-aza-2' -deoxycytidine treatment. Here I investigated changes in hMLHI mRNA splicing profiles in normal fibroblasts and colon cancer-derived human cell lines. I established the types and frequencies of hMLHI mRNA transcripts generated under baseline conditions, after hydrogen peroxide induced oxidative stress, and in acutely 5-aza-2' -deoxycytidine-treated and stably derepressed cancer cell lines. I found that hMLHI is extensively spliced under all conditions including baseline (50% splice variants), the splice variant distribution changes in response to oxidative stress, and certain splice variants are sensitive to 5- aza-2' -deoxycytidine treatment: Splice variant diversity and frequency of exon 17 skipping correlates with the level of hMLHI promoter methylation suggesting a link between promoter methylation and mRNA splicing.

Cell-selective modulation of the Drosophila neuromuscular system by a neuropeptide

Neuropeptides can modulate physiological properties of neurons in a cell-specific manner. The present work examines whether a neuropeptide can also modulate muscle tissue in a cell-specific manner, using identified muscle cells in third instar larvae of fruit flies. DPKQDFMRFa, a modulatory peptide in the fruit fly Drosophila melanogaster, has been shown to enhance transmitter release from motor neurons and to elicit contractions by a direct effect on muscle cells. We report that DPKQDFMRFa causes a nifedipine-sensitive drop in input resistance in some muscle cells (6 and 7) but not others (12 and 13). The peptide also increased the amplitude of nerve-evoked contractions and compound excitatory junctional potentials (EJPs) to a greater degree in muscle cells 6 and 7 than 12 and 13. Knocking down FMRFa receptor (FR) expression separately in nerve and muscle indicate that both presynaptic and postsynaptic FR expression contributed to the enhanced contractions, but EJP enhancement was due mainly to presynaptic expression. Muscle-ablation showed that DPKQDFMRFa induced contractions and enhanced nerve-evoked contractions more strongly in muscle cells 6 and 7 than cells 12 and 13. In situ hybridization indicated that FR expression was significantly greater in muscle cells 6 and 7 than 12 and 13. Taken together, these results indicate that DPKQDFMRFa can elicit cell-selective effects on muscle fibres. The ability of neuropeptides to work in a cell-selective manner on neurons and muscle cells may help explain why so many peptides are encoded in invertebrate and vertebrate genomes.

A mechanism for co-transcriptional recruitment of mRNA localization factor on nascent mRNAs in budding yeast

Le transport et la localisation des ARN messagers permettent de réguler l’expression spatiale et temporelle de facteurs spécifiques impliqués dans la détermination du destin cellulaire, la plasticité synaptique, la polarité cellulaire et la division asymétrique des cellules. Chez S.cerevisiæ, plus de trente transcrits sont transportés activement vers le bourgeon cellulaire. Parmi ces transcrits, l’ARNm ASH1 (asymetric synthesis of HO) est localisé à l’extrémité du bourgeon pendant l’anaphase. Ce processus va entrainer une localisation asymétrique de la protéine Ash1p, qui sera importée uniquement dans le noyau de la cellule fille, où elle entraine le changement de type sexuel. La localisation asymétrique de l’ARNm ASH1, et donc de Ash1p, implique la présence de différents facteurs de localisation. Parmi ces facteurs, les protéines She (She1p/Myo4p, She2p et She3p) et les répresseurs traductionnels (Puf6p, Loc1p et Khd1p) participent à ce mécanisme. La protéine navette She2p est capable de lier l’ARNm ASH1 et va entrainer le ciblage de cet ARNm vers l’extrémité du bourgeon en recrutant le complexe She3p-Myo4p. Des répresseurs traductionnels régulent la traduction de cet ARNm et évitent l’expression ectopique de la protéine Ash1p pendant son transport. Alors que la fonction cytoplasmique de She2p sur la localisation des ARNm est connue, sa fonction nucléaire est encore inconnue. Nous avons montré que She2p contient une séquence de localisation nucléaire non classique qui est essentielle à son import nucléaire médié par l’importine α (Srp1p). L’exclusion de She2p du noyau par mutation de son NLS empêche la liaison de Loc1p et Puf6p sur l’ARNm ASH1, entrainant un défaut de localisation de l’ARNm et de la protéine. Pour étudier plus en détail l’assemblage de la machinerie de localisation des ARNm dans le noyau, nous avons utilisé des techniques d’immunoprécipitation de chromatine afin de suivre le recrutement des facteurs de localisation et des répresseurs traductionnels sur les ARNm naissants. Nous avons montré que She2p est recruté sur le gène ASH1 pendant sa transcription, via son interaction avec l’ARNm ASH1 naissant. Puf6p est également recruté sur ASH1, mais d’une manière dépendante de la présence de She2p. De façon intéressante, nous avons détecté une interaction entre She2p et la plus grande sous-unité de l’ARN polymérase II (Rpb1p). Cette interaction est détectée avec la forme active en élongation de l’ARN polymérase II. Nous avons également démontré que She2p interagit avec le complexe d’élongation de la transcription Spt4p/Spt5p. Une délétion de SPT4 ou une mutation dans SPT5 (Ts spt5) à température restrictive empêche l’interaction entre She2p et Rpb1p, et diminue le recrutement de She2p au gène ASH1, entrainant un défaut de localisation de l’ARNm et un défaut de localisation asymétrique de la protéine Ash1p. De manière globale, nos résultats montrent que les facteurs impliqués dans la localisation cytoplasmique des ARNm et dans leur contrôle traductionnel sont recrutés de façon co-transcriptionnelle sur les ARNm naissants via leur interaction avec la machinerie de transcription, suggèrant un rôle important de la machinerie transcriptionelle dans la localisation des ARNm.

Purification and identification of specific RNA-binding protein that binds to the 3'UTR region of cytochrome P450aromatase mRNA in bovine granulosa cells

Mémoire numérisé par la Division de la gestion de documents et des archives de l'Université de Montréal

A proteome-wide strategy reveals a novel mechanism of control of cell cycle progression through modulation of cyclin mRNA stability

La quantité de données générée dans le cadre d'étude à grande échelle du réseau d'interaction protéine-protéine dépasse notre capacité à les analyser et à comprendre leur sens; d'une part, par leur complexité et leur volume, et d'un autre part, par la qualité du jeu de donnée produit qui semble bondé de faux positifs et de faux négatifs. Cette dissertation décrit une nouvelle méthode de criblage des interactions physique entre protéines à haut débit chez Saccharomyces cerevisiae, la complémentation de fragments protéiques (PCA). Cette approche est accomplie dans des cellules intactes dans les conditions natives des protéines; sous leur promoteur endogène et dans le respect des contextes de modifications post-traductionnelles et de localisations subcellulaires. Une application biologique de cette méthode a permis de démontrer la capacité de ce système rapporteur à répondre aux questions d'adaptation cellulaire à des stress, comme la famine en nutriments et un traitement à une drogue. Dans le premier chapitre de cette dissertation, nous avons présenté un criblage des paires d'interactions entre les protéines résultant des quelques 6000 cadres de lecture de Saccharomyces cerevisiae. Nous avons identifié 2770 interactions entre 1124 protéines. Nous avons estimé la qualité de notre criblage en le comparant à d'autres banques d'interaction. Nous avons réalisé que la majorité de nos interactions sont nouvelles, alors que le chevauchement avec les données des autres méthodes est large. Nous avons pris cette opportunité pour caractériser les facteurs déterminants dans la détection d'une interaction par PCA. Nous avons remarqué que notre approche est sous une contrainte stérique provenant de la nécessité des fragments rapporteurs à pouvoir se rejoindre dans l'espace cellulaire afin de récupérer l'activité observable de la sonde d'interaction. L'intégration de nos résultats aux connaissances des dynamiques de régulations génétiques et des modifications protéiques nous dirigera vers une meilleure compréhension des processus cellulaires complexes orchestrés aux niveaux moléculaires et structuraux dans les cellules vivantes. Nous avons appliqué notre méthode aux réarrangements dynamiques opérant durant l'adaptation de la cellule à des stress, comme la famine en nutriments et le traitement à une drogue. Cette investigation fait le détail de notre second chapitre. Nous avons déterminé de cette manière que l'équilibre entre les formes phosphorylées et déphosphorylées de l'arginine méthyltransférase de Saccharomyces cerevisiae, Hmt1, régulait du même coup sont assemblage en hexamère et son activité enzymatique. L'activité d'Hmt1 a directement un impact dans la progression du cycle cellulaire durant un stress, stabilisant les transcrits de CLB2 et permettant la synthèse de Cln3p. Nous avons utilisé notre criblage afin de déterminer les régulateurs de la phosphorylation d'Hmt1 dans un contexte de traitement à la rapamycin, un inhibiteur de la kinase cible de la rapamycin (TOR). Nous avons identifié la sous-unité catalytique de la phosphatase PP2a, Pph22, activé par l'inhibition de la kinase TOR et la kinase Dbf2, activé durant l'entrée en mitose de la cellule, comme la phosphatase et la kinase responsable de la modification d'Hmt1 et de ses fonctions de régulations dans le cycle cellulaire. Cette approche peut être généralisée afin d'identifier et de lier mécanistiquement les gènes, incluant ceux n'ayant aucune fonction connue, à tout processus cellulaire, comme les mécanismes régulant l'ARNm.

Caractérisation pharmacologique et moléculaire des dyskinésies tardives chez un modèle de primate non humain

Les dyskinésies tardives (DT) sont des troubles moteurs associés à l’utilisation chronique des antagonistes des récepteurs dopaminergiques D2 tels que les antipsychotiques et le métoclopramide. Ces dyskinésies correspondent à une incoordination motrice portant préférentiellement sur la musculature oro-faciale. La gestion des DT s'est imposée comme défi de santé publique surtout en l’absence d’une alternative thérapeutique efficace et abordable. L’hypothèse classiquement avancée pour expliquer la physiopathologie des DT inhérente au traitement par les antipsychotiques s’articule autour de l’hypersensibilité des récepteurs dopaminergiques D2, cibles principales de ces molécules. Néanmoins, plusieurs données remettent la véracité de cette hypothèse en question. Hypothèse: nous proposons que le blocage chronique des récepteurs dopaminergiques soit effectivement responsable d’un phénomène d’hypersensibilisation mais contrairement à l’hypothèse classique, cette hypersensibilisation porterait sur des paramètres de la transmission dopaminergique autres que les récepteurs D2. De même nous postulons que cette hypersensibilisation se traduirait par des altérations des cascades signalétiques au niveau des cellules du striatum. Ces altérations aboutissent à des changements portant sur le récepteur nucléaire (Nur77), qui est hautement associé au système dopaminergique; l’induction de ces récepteurs déclencherait des cascades associées à la compensation ou à la genèse des DT. Matériels et méthodes: 23 femelles Cebus apella, réparties en 3 groupes: groupe halopéridol, groupe clozapine, et groupe contrôle, ont été exposées aux traitements respectifs pendant 6-36 mois. Après l’analyse comportementale, les animaux ont été décapités et leurs cerveaux isolés pour fin d’analyse. Hybridation in situ: nous avons fait appel à cette technique pour mesurer l’expression de l’ARNm de Nur77 et du neuropeptide enképhaline. Hybridation in situ double: nous avons exploités cette technique pour identifier les populations neuronales exprimant les récepteurs dopaminergiques D3 et localiser leur éventuelle induction. Autoradiographies des récepteurs dopaminergiques D1, D2 et D3 et autoradiographies des récepteurs i glutamatergiques mGluR5. Ces autoradiographies avaient pour objectif d’évaluer l’expression de ces différents récepteurs. Mutagenèse dirigée et transfection cellulaire: nous faisons appel à ces techniques pour reproduire le polymorphisme identifié au niveau de la région 3’UTR de l’ARNm Nur77 et évaluer l’impact que pourrait avoir ce polymorphisme sur la stabilité de l’ARNm Nur77 sinon sur l’expression de la protèine Nur77. Western Blot des kinases ERK 1 et 2: cette technique nous a servi comme moyen pour quantifier l’expression globale de ces kinases. Analyses statistiques: l’expression de l’ARNm Nur77 a été évaluée en utilisant l’analyse de la variance à un seul facteur (One way ANOVA). Nous avons procédé de la même façon pour mesurer l’expression des récepteurs D2, D3 et mGluR5. Résultats: le groupe des animaux traités par l’halopéridol montre une plus forte expression des récepteurs D3 par rapport aux sujets des autres groupes. Cette expression se produit au niveau des neurones de la voie directe. De plus, cette augmentation corrèle positivement avec la sévérité des DT. L’expression des récepteurs D2 et mGluR5 reste relativement inchangée entre les différents groupes, alors qu’un gradient d’expression a été observé pour le récepteur D1. Par ailleurs, Nur77 est induit par l’halopéridol, alors que son expression semble baisser chez les animaux traités par la clozapine. L’induction de l’expression de Nur77 par l’halopéridol est plus accrue chez les animaux non dyskinétiques. Les animaux traités par la clozapine démontrent une expression amoindrie de l’ARNm de Nur77 qui tend à être plus faible que l’expression de base. D’autre part, la présence du polymorphisme au niveau de la région 3’UTR semble affecter l’expression cellulaire de Nur77. Conclusion: ces résultats confortent notre hypothèse concernant l’existence d’un phénomène d’hypersensibilisation prenant place suite un traitement chronique par les antipsychotiques. Ce phénomène s’est traduit par une augmentation de l’expression des récepteurs D3 sans porter sur les récepteurs D2 tel que prôné classiquement. Cette hypersensibilisation des récepteurs D3 implique également l’existence d’un débalancement des voies striatales pouvant ainsi sous tendre l’apparition des DT. Ces résultats dévoilent ainsi un nouveau mécanisme qui pourrait contribuer à l’apparition des DT et pourraient permettre une meilleure gestion, nous l’espérons, des DT à l’échelle clinique.

A single amino acid substitution in the mRNA capping enzyme λ2 of a mammalian orthoreovirus mutant increases interferon sensitivity.

In the last few years, the development of a plasmid-based reverse genetics system for mammalian reovirus has allowed the production and characterization of mutant viruses. This could be especially significant in the optimization of reovirus strains for virotherapeutic applications, either as gene vectors or oncolytic viruses. The genome of a mutant virus exhibiting increased sensitivity to interferon was completely sequenced and compared with its parental virus. Viruses corresponding to either the parental or mutant viruses were then rescued by reverse genetics and shown to exhibit the expected phenotypes. Systematic rescue of different viruses harboring either of the four parental genes in a mutant virus backbone, or reciprocally, indicated that a single amino acid substitution in one of λ2 methyltransferase domains is the major determinant of the difference in interferon sensitivity between these two viruses.

Studies of cap-independent mRNA translation in Drosophila melanogaster

Control of protein synthesis is a key step in the regulation of gene expression during apoptosis and the heat shock response. Under such conditions, cap-dependent translation is impaired and Internal Ribosome Entry Site (IRES)-dependent translation plays a major role in mammalian cells. Although the role of IRES-dependent translation during apoptosis has been mainly studied in mammals, its role in the translation of Drosophila apoptotic genes has not been yet studied. The observation that the Drosophila mutant embryos for the cap-binding protein, the eukaryotic initiation factor eIF4E, exhibits increased apoptosis in correlation with up-regulated proapoptotic gene reaper (rpr) transcription constitutes the first evidence for the existence of a cap-independent mechanism for the translation of Drosophila proapoptotic genes. The mechanism of translation of rpr and other proapoptotic genes was investigated in this work. We found that the 5 UTR of rpr mRNA drives translation in an IRES-dependent manner. It promotes the translation of reporter RNAs in vitro either in the absence of cap, in the presence of cap competitors, or in extracts derived from heat shocked and eIF4E mutant embryos and in vivo in cells transfected with reporters bearing a non functional cap structure, indicating that cap recognition is not required in rpr mRNA for translation. We also show that rpr mRNA 5 UTR exhibits a high degree of similarity with that of Drosophila heat shock protein 70 mRNA (hsp70), an antagonist of apoptosis, and that both are able to conduct IRES-mediated translation. The proapoptotic genes head involution defective (hid) and grim, but not sickle, also display IRES activity. Studies of mRNA association to polysomes in embryos indicate that both rpr, hsp70, hid and grim endogenous mRNAs are recruited to polysomes in embryos in which apoptosis or thermal stress was induced. We conclude that hsp70 and, on the other hand, rpr, hid and grim which are antagonizing factors during apoptosis, use a similar mechanism for protein synthesis. The outcome for the cell would thus depend on which protein is translated under a given stress condition. Factors involved in the differential translation driven by these IRES could play an important role. For this purpose, we undertook the identification of the ribonucleoprotein (RNP) complexes assembled onto the 5 UTR of rpr mRNA. We established a tobramycin-affinity-selection protocol that allows the purification of specific RNP that can be further analyzed by mass spectrometry. Several RNA binding proteins were identified as part of the rpr 5 UTR RNP complex, some of which have been related to IRES activity. The involvement of one of them, the La antigen, in the translation of rpr mRNA, was established by RNA-crosslinking experiments using recombinant protein and rpr 5 UTR and by the analysis of the translation efficiency of reporter mRNAs in Drosophila cells after knock down of the endogenous La by RNAi experiments. Several uncharacterized proteins were also identified, suggesting that they might play a role during translation, during the assembly of the translational machinery or in the priming of the mRNA before ribosome recognition. Our data provide evidence for the involvement of La antigen in the translation of rpr mRNA and set a protocol for purification of tagged-RNA-protein complexes from cytoplasmic extracts. To further understand the mechanisms of translation initiation in Drosophila, we analyzed the role of eIF4B on cap-dependent and cap-independent translation. We showed that eIF4B is mostly involved in cap-, but not IRES-dependent translation as it happens in mammals.