1000 resultados para inseminação artificial em tempo fixo


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pós-graduação em Ginecologia, Obstetrícia e Mastologia - FMB

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pós-graduação em Medicina Veterinária - FMVZ

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pós-graduação em Medicina Veterinária - FMVZ

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pós-graduação em Medicina Veterinária - FMVZ

Relevância:

100.00% 100.00%

Publicador:

Resumo:

O objetivo deste estudo foi avaliar a eficiência do uso de duas doses de PGF associadas ou não à administração de hCG no início do estro sobre os parâmetros reprodutivos de cabras leiteiras. Um total de 29 cabras receberam duas doses de 30 µg d-cloprostenol pela via latero-vulvar com 10 dias de intervalo (Dia 1 e Dia 10). As cabras foram alocadas para receberem o hCG (250 IU) ou salina i.m. no momento em que o estro foi detectado. Depois da realização da segunda dose de PGF, o estro foi monitorado e exames ultrassonográficos foram realizados duas vezes ao dia. Todas as fêmeas foram inseminadas 16 h após o inicio do estro. Amostras de sangue foram coletadas diariamente para determinação das concentrações plasmáticas de progesterona. O uso do hCG no momento do início do estro não afetou os parâmetros estudados e, portanto, os dados serão apresentados agrupados. A taxa de manifestação de estro foi similar (P > 0,05) na primeira (75,9% - 22/29) ou na segunda dose de PGF (79,3% - 23/29). O intervalo entre a administração de PGF e o início do estro foi maior (P < 0,05) no Dia 1 (75,8±53,9 h) que no Dia 10 (47,7±10,1 h). Duração do estro também diferiu (P < 0,05) 35,4±15,9 (Dia 1) vs 26,8±15, 0 h (Dia 10). A taxa de ovulação foi 79,3% (23/29) após a segunda dose PGF. Não foi encontrada diferença (P>0,05) entre os grupos experimentais quanto aos parâmetros reprodutivos: intervalo entre a aplicação da segunda dose e a ovulação (86,6±11,4h), intervalo do estro a ocorrência da ovulação (39,9±12,3h), diâmetro do maior folículo (7,2±1,4) e número de ovulações (1,8±0,6). No Dia 1, 52,4% (11/21) apresentavam concentrações de progesterona < 1 ng/mL. No Dia 10, 100% dos animais apresentavam concentrações >1ng/mL. O presente estudo permite concluir que o estro pode ser eficientemente sincronizado em cabras leiteiras com duas doses de PGF intervaladas em 10 dias. Novas pesquisas devem se realizadas para avaliar diferentes doses e momentos de utilização do hCG.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The effectiveness of using frozen sheep semen in artificial insemination programs requires the development of extenders and freezing protocols that will increase pregnancy rate of inseminated females. This work aimed to survey the main extenders, additives and external and internal cryoprotectants that have been employed to improve the maintenance levels of sperm parameters after the freezing-thawing process. Better rates of post-thawing sheep sperm viability may be obtained with changes in the freezing extender composition, whether by the adjustment of its components or by introducing additives that inhibit the occurrence of sperm changes during the cryopreservation process. Thus, the possible changes proposed must take into consideration the intrinsic characteristics of ram semen and the individual variability among animals. It is important to emphasize that the sperm cryopreservation effectiveness requires that all process steps are conducted in an integrated manner, to maximize the fertility rate of frozen ram semen.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pós-graduação em Medicina Veterinária - FMVZ

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pós-graduação em Biotecnologia Animal - FMVZ

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pós-graduação em Ciência e Tecnologia Animal - FEIS

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Methods of semen cryopreservation allow changes in spermatic cells, such as damage in plasma and acrossomal membrane and modifications in mitochondrial function due to a disorder in the lipidic bilayer. For effective oocyte fertilization, spermatozoa require functional competent membranes, and intact organelles, acrosome and DNA. However, most laboratory methods used to evaluate semen quality are not highly correlated with fertilizing capacity. The discovery of a variety of fluorochromes and compounds conjugated to fluorescent probes has enabled an accurate assessment of the viability, integrity and function of spermatozoa. Among the most used probes that label the various compartments of the sperm cell there are the membrane impermeable fluorescent dyes to test the membrane integrity, as well as acylated dyes that pass the intact membrane. For the acrossomal integrity the most commonly used method is lectins labeled by a fluorescent probe. The acrosome reaction and spermatic capacitation is detected by the evaluation of membrane architecture and disorder of lipids in plasma membrane. Mitochondrial function can be determined using markers for their aerobic activity. The DNA status of spermatozoa has been determined using the metachromatic properties of Acridine Orange, and the DNA fragmentation can also be assessed by TUNEL assay. Finally, DNA condensation is analyzed using a single cell DNA gel electrophoresis assay that indicates DNA compactation. This monograph aims to compile the various tests used to detect damaged spermatozoa under cryopreservation methods, searching for improve the predictive value of semen analysis with the intention of a successful conception