How demography, life history, and kinship shape the evolution of genomic imprinting.

How phenomena like helping, dispersal, or the sex ratio evolve depends critically on demographic and life-history factors. One phenotype that is of particular interest to biologists is genomic imprinting, which results in parent-of-origin-specific gene expression and thus deviates from the predictions of Mendel's rules. The most prominent explanation for the evolution of genomic imprinting, the kinship theory, originally specified that multiple paternity can cause the evolution of imprinting when offspring affect maternal resource provisioning. Most models of the kinship theory do not detail how population subdivision, demography, and life history affect the evolution of imprinting. In this work, we embed the classic kinship theory within an island model of population structure and allow for diverse demographic and life-history features to affect the direction of selection on imprinting. We find that population structure does not change how multiple paternity affects the evolution of imprinting under the classic kinship theory. However, if the degree of multiple paternity is not too large, we find that sex-specific migration and survival and generation overlap are the primary factors determining which allele is silenced. This indicates that imprinting can evolve purely as a result of sex-related asymmetries in the demographic structure or life history of a species.

Detection of CBP rearrangements in acute myelogenous leukemia with t(8;16).

The CREB-binding protein (CBP) is a large nuclear protein that regulates many signal transduction pathways and is involved in chromatin-mediated transcription. The translocation t(8;16)(p11;p13.3) consistently disrupts two genes: the CBP gene on chromosome band 16p13.3 and the MOZ gene on chromosome band 8p11. Although a fusion of these two genes as a result of the translocation is expected, attempts at detecting the fusion transcript by reverse transcriptase polymerase chain reaction (RT-PCR) have proven difficult; to date, only one in-frame CBP/MOZ fusion transcript has been reported. We therefore sought other reliable means of detecting CBP rearrangements. We applied fluorescence in situ hybridization (FISH) and Southern blot analyses to a series of AML patients with a t(8;16) and detected DNA rearrangements of both the CBP and the MOZ loci in all cases tested. All six cases examined for CBP rearrangements have breakpoints within a 13 kb breakpoint cluster region at the 5' end of the CBP gene. Additionally, we used a MOZ cDNA probe to construct a surrounding cosmid contig and detect DNA rearrangements in three t(8;16) cases, all of which display rearrangements within a 6 kb genomic fragment of the MOZ gene. We have thus developed a series of cosmid probes that consistently detect the disruption of the CBP gene in t(8;16) patients. These clones could potentially be used to screen other cancer-associated or congenital translocations involving chromosome band 16p13.3 as well.

Expression quantitative trait locus mapping across water availability environments reveals contrasting associations with genomic features in Arabidopsis.

The regulation of gene expression is crucial for an organism's development and response to stress, and an understanding of the evolution of gene expression is of fundamental importance to basic and applied biology. To improve this understanding, we conducted expression quantitative trait locus (eQTL) mapping in the Tsu-1 (Tsushima, Japan) × Kas-1 (Kashmir, India) recombinant inbred line population of Arabidopsis thaliana across soil drying treatments. We then used genome resequencing data to evaluate whether genomic features (promoter polymorphism, recombination rate, gene length, and gene density) are associated with genes responding to the environment (E) or with genes with genetic variation (G) in gene expression in the form of eQTLs. We identified thousands of genes that responded to soil drying and hundreds of main-effect eQTLs. However, we identified very few statistically significant eQTLs that interacted with the soil drying treatment (GxE eQTL). Analysis of genome resequencing data revealed associations of several genomic features with G and E genes. In general, E genes had lower promoter diversity and local recombination rates. By contrast, genes with eQTLs (G) had significantly greater promoter diversity and were located in genomic regions with higher recombination. These results suggest that genomic architecture may play an important a role in the evolution of gene expression.

A dual functional origin of transfer in the ICEclc genomic island of Pseudomonas knackmussii B13.

Genomic islands (GEIs) are large DNA segments, present in most bacterial genomes, that are most likely acquired via horizontal gene transfer. Here, we study the self-transfer system of the integrative and conjugative element ICEclc of Pseudomonas knackmussii B13, which stands model for a larger group of ICE/GEI with syntenic core gene organization. Functional screening revealed that unlike conjugative plasmids and other ICEs ICEclc carries two separate origins of transfer, with different sequence context but containing a similar repeat motif. Conjugation experiments with GFP-labelled ICEclc variants showed that both oriTs are used for transfer and with indistinguishable efficiencies, but that having two oriTs results in an estimated fourfold increase of ICEclc transfer rates in a population compared with having a single oriT. A gene for a relaxase essential for ICEclc transfer was also identified, but in vivo strand exchange assays suggested that the relaxase processes both oriTs in a different manner. This unique dual origin of transfer system might have provided an evolutionary advantage for distribution of ICE, a hypothesis that is supported by the fact that both oriT regions are conserved in several GEIs related to ICEclc.

Comparative genomic and phylogeographic analysis of Mycobacterium leprae.

Reductive evolution and massive pseudogene formation have shaped the 3.31-Mb genome of Mycobacterium leprae, an unculturable obligate pathogen that causes leprosy in humans. The complete genome sequence of M. leprae strain Br4923 from Brazil was obtained by conventional methods (6x coverage), and Illumina resequencing technology was used to obtain the sequences of strains Thai53 (38x coverage) and NHDP63 (46x coverage) from Thailand and the United States, respectively. Whole-genome comparisons with the previously sequenced TN strain from India revealed that the four strains share 99.995% sequence identity and differ only in 215 polymorphic sites, mainly SNPs, and by 5 pseudogenes. Sixteen interrelated SNP subtypes were defined by genotyping both extant and extinct strains of M. leprae from around the world. The 16 SNP subtypes showed a strong geographical association that reflects the migration patterns of early humans and trade routes, with the Silk Road linking Europe to China having contributed to the spread of leprosy.

Perspective: from molecular endocrinology of mouse to genomic endocrinology of animals.

This short perspective explores some ways in which new genomic methodologies impact the study of endocrine signaling. Emphasis is put on the impact of studying species which are not molecular biology models. This opens the door to using knowledge molecular endocrinology in areas of biology as distant as conservation biology, as well as enriching endocrinology with information from biodiversity and natural variation.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Evolution of the P-type II ATPase gene family in the fungi and presence of structural genomic changes among isolates of Glomus intraradices.

BACKGROUND: The P-type II ATPase gene family encodes proteins with an important role in adaptation of the cell to variation in external K+, Ca2+ and Na2+ concentrations. The presence of P-type II gene subfamilies that are specific for certain kingdoms has been reported but was sometimes contradicted by discovery of previously unknown homologous sequences in newly sequenced genomes. Members of this gene family have been sampled in all of the fungal phyla except the arbuscular mycorrhizal fungi (AMF; phylum Glomeromycota), which are known to play a key-role in terrestrial ecosystems and to be genetically highly variable within populations. Here we used highly degenerate primers on AMF genomic DNA to increase the sampling of fungal P-Type II ATPases and to test previous predictions about their evolution. In parallel, homologous sequences of the P-type II ATPases have been used to determine the nature and amount of polymorphism that is present at these loci among isolates of Glomus intraradices harvested from the same field. RESULTS: In this study, four P-type II ATPase sub-families have been isolated from three AMF species. We show that, contrary to previous predictions, P-type IIC ATPases are present in all basal fungal taxa. Additionally, P-Type IIE ATPases should no longer be considered as exclusive to the Ascomycota and the Basidiomycota, since we also demonstrate their presence in the Zygomycota. Finally, a comparison of homologous sequences encoding P-type IID ATPases showed unexpectedly that indel mutations among coding regions, as well as specific gene duplications occur among AMF individuals within the same field. CONCLUSION: On the basis of these results we suggest that the diversification of P-Type IIC and E ATPases followed the diversification of the extant fungal phyla with independent events of gene gains and losses. Consistent with recent findings on the human genome, but at a much smaller geographic scale, we provided evidence that structural genomic changes, such as exonic indel mutations and gene duplications are less rare than previously thought and that these also occur within fungal populations.

"Next-generation" Sequencing (NGS): The new genomic revolution

In the past 5 years "Next-generation" Sequencing (NGS) technologies have transformed genomics by delivering fast, inexpensive and accurate genomeinformation changing the way we think about scientific approaches in basic,applied and clinical research. The inexpensive production of large volumes ofsequence data is the main advantage over the automated Sanger method,making this new technology useful for many applications. In this chapter, a brieftechnical review of NGS technologies is given, along with the keys to NGSsuccess and a broad range of applications for NGS technologies.

Chemical probes that differentially modulate peroxisome proliferator-activated receptor alpha and BLTR, nuclear and cell surface receptors for leukotriene B(4).

Peroxisome proliferator-activated receptor alpha (PPARalpha)is a nuclear receptor for various fatty acids, eicosanoids, and hypolipidemic drugs. In the presence of ligand, this transcription factor increases expression of target genes that are primarily associated with lipid homeostasis. We have previously reported PPARalpha as a nuclear receptor of the inflammatory mediator leukotriene B(4) (LTB(4)) and demonstrated an anti-inflammatory function for PPARalpha in vivo (Devchand, P. R., Keller, H., Peters, J. M., Vazquez, M., Gonzalez, F. J., and Wahli, W. (1996) Nature 384, 39-43). LTB(4) also has a cell surface receptor (BLTR) that mediates proinflammatory events, such as chemotaxis and chemokinesis (Yokomizo, T., Izumi, T., Chang, K., Takuwa, Y., and Shimizu, T. (1997) Nature 387, 620-624). In this study, we report on chemical probes that differentially modulate activity of these two LTB(4) receptors. The compounds selected were originally characterized as synthetic BLTR effectors, both agonists and antagonists. Here, we evaluate the compounds as effectors of the three PPAR isotypes (alpha, beta, and gamma) by transient transfection assays and also determine whether the compounds are ligands for these nuclear receptors by coactivator-dependent receptor ligand interaction assay, a semifunctional in vitro assay. Because the compounds are PPARalpha selective, we further analyze their potency in a biological assay for the PPARalpha-mediated activity of lipid accumulation. These chemical probes will prove invaluable in dissecting processes that involve nuclear and cell surface LTB(4) receptors and also aid in drug discovery programs.

The clc element of Pseudomonas sp. strain B13, a genomic island with various catabolic properties.

Pseudomonas sp. strain B13 is a bacterium known to degrade chloroaromatic compounds. The properties to use 3- and 4-chlorocatechol are determined by a self-transferable DNA element, the clc element, which normally resides at two locations in the cell's chromosome. Here we report the complete nucleotide sequence of the clc element, demonstrating the unique catabolic properties while showing its relatedness to genomic islands and integrative and conjugative elements rather than to other known catabolic plasmids. As far as catabolic functions, the clc element harbored, in addition to the genes for chlorocatechol degradation, a complete functional operon for 2-aminophenol degradation and genes for a putative aromatic compound transport protein and for a multicomponent aromatic ring dioxygenase similar to anthranilate hydroxylase. The genes for catabolic functions were inducible under various conditions, suggesting a network of catabolic pathway induction. For about half of the open reading frames (ORFs) on the clc element, no clear functional prediction could be given, although some indications were found for functions that were similar to plasmid conjugation. The region in which these ORFs were situated displayed a high overall conservation of nucleotide sequence and gene order to genomic regions in other recently completed bacterial genomes or to other genomic islands. Most notably, except for two discrete regions, the clc element was almost 100% identical over the whole length to a chromosomal region in Burkholderia xenovorans LB400. This indicates the dynamic evolution of this type of element and the continued transition between elements with a more pathogenic character and those with catabolic properties.

A genomic island present along the bacterial chromosome of the Parachlamydiaceae UWE25, an obligate amoebal endosymbiont, encodes a potentially functional F-like conjugative DNA transfer system.

BACKGROUND: The genome of Protochlamydia amoebophila UWE25, a Parachlamydia-related endosymbiont of free-living amoebae, was recently published, providing the opportunity to search for genomic islands (GIs). RESULTS: On the residual cumulative G+C content curve, a G+C-rich 19-kb region was observed. This sequence is part of a 100-kb chromosome region, containing 100 highly co-oriented ORFs, flanked by two 17-bp direct repeats. Two identical gly-tRNA genes in tandem are present at the proximal end of this genetic element. Several mobility genes encoding transposases and bacteriophage-related proteins are located within this chromosome region. Thus, this region largely fulfills the criteria of GIs. The G+C content analysis shows that several modules compose this GI. Surprisingly, one of them encodes all genes essential for F-like conjugative DNA transfer (traF, traG, traH, traN, traU, traW, and trbC), involved in sex pilus retraction and mating pair stabilization, strongly suggesting that, similarly to the other F-like operons, the parachlamydial tra unit is devoted to DNA transfer. A close relatedness of this tra unit to F-like tra operons involved in conjugative transfer is confirmed by phylogenetic analyses performed on concatenated genes and gene order conservation. These analyses and that of gly-tRNA distribution in 140 GIs suggest a proteobacterial origin of the parachlamydial tra unit. CONCLUSIONS: A GI of the UWE25 chromosome encodes a potentially functional F-like DNA conjugative system. This is the first hint of a putative conjugative system in chlamydiae. Conjugation most probably occurs within free-living amoebae, that may contain hundreds of Parachlamydia bacteria tightly packed in vacuoles. Such a conjugative system might be involved in DNA transfer between internalized bacteria. Since this system is absent from the sequenced genomes of Chlamydiaceae, we hypothesize that it was acquired after the divergence between Parachlamydiaceae and Chlamydiaceae, when the Parachlamydia-related symbiont was an intracellular bacteria. It suggests that this heterologous DNA was acquired from a phylogenetically-distant bacteria sharing an amoebal vacuole. Since Parachlamydiaceae are emerging agents of pneumonia, this GI might be involved in pathogenicity. In future, conjugative systems might be developed as genetic tools for Chlamydiales.

RNA interference: a new and powerful tool for functional genomic analysis.

In many species, the introduction of double-stranded RNA induces potent and specific gene silencing, referred to as RNA interference. This phenomenon, which is based on targeted degradation of mRNAs and occurs in almost any eukaryote, from trypanosomes to mice including plants and fungi, has sparked general interest from both applied and fundamental standpoints. RNA interference, which is currently used to investigate gene function in a variety of systems, is linked to natural resistance to viruses and transposon silencing, as if it were a primitive immune system involved in genome surveillance. Here, we review the mechanism of RNA interference in post-transcriptional gene silencing, its function in nature, its value for functional genomic analysis, and the modifications and improvements that may make it more efficient and inheritable. We also discuss the future directions of this versatile technique in both fundamental and applied science.

Combining chromosomal arm status and significantly aberrant genomic locations reveals new cancer subtypes.

Many types of tumors exhibit characteristic chromosomal losses or gains, as well as local amplifications and deletions. Within any given tumor type, sample specific amplifications and deletions are also observed. Typically, a region that is aberrant in more tumors, or whose copy number change is stronger, would be considered as a more promising candidate to be biologically relevant to cancer. We sought for an intuitive method to define such aberrations and prioritize them. We define V, the "volume" associated with an aberration, as the product of three factors: (a) fraction of patients with the aberration, (b) the aberration's length and (c) its amplitude. Our algorithm compares the values of V derived from the real data to a null distribution obtained by permutations, and yields the statistical significance (p-value) of the measured value of V. We detected genetic locations that were significantly aberrant, and combine them with chromosomal arm status (gain/loss) to create a succinct fingerprint of the tumor genome. This genomic fingerprint is used to visualize the tumors, highlighting events that are co-occurring or mutually exclusive. We apply the method on three different public array CGH datasets of Medulloblastoma and Neuroblastoma, and demonstrate its ability to detect chromosomal regions that were known to be altered in the tested cancer types, as well as to suggest new genomic locations to be tested. We identified a potential new subtype of Medulloblastoma, which is analogous to Neuroblastoma type 1.