Population pharmacokinetics and pharmacodynamics: An underutilized resource

A meeting was convened in Canberra, Australia, at the request of the Australian Drug Evaluation Committee (ADEC), on December 3-4, 1997 to discuss the role of population pharmacokinetics and pharmacodynamics in drug evaluation and development. The ADEC was particularly concerned about registration of drugs in the pediatric age group. The population approach could be used more often than is currently the case in pharmacokinetic and pharmacodynamic studies to provide valuable information for the safe and effective use of drugs in neonates, infants, and children. The meeting ultimately broadened to include discussion about other subgroups. The main conclusions of the meeting were: 1. The population approach, pharmacokinetic and pharmacodynamic analysis, is a valuable tool both for drug registration purposes and for optimal dosing of drugs in specific groups of patients, 2. Population pharmacokinetic and pharmacodynamic studies are able to fill in the gaps' in registration of drugs, for example, to provide information on optimal pediatric dosing. Such studies provide a basis for enhancing product information to improve rational prescribing, 3. Expertise is required to perform the population studies and expertise, with a clinical perspective, is also required to evaluate such studies if they are to be submitted as part of a drug registration dossier Such expertise is available in the Australasian region and is increasing. Centers of excellence with the appropriate expertise to advise and assist should be encouraged to develop and grow in the region, 4. The use of the population approach by the pharmaceutical industry needs to be encouraged to provide valuable information not obtainable by other techniques. The acceptance of population pharmacokinetic and pharmacodynamic analyses by regulatory agencies also needs to be encouraged, and 5. Development of the population approach to pharmacokinetics and pharmacodynamics is needed from a public health perspective to ensure that all available information is collected and used to improve the way drugs are used. This important endeavor needs funding and support at the local and international levels.

Theory of multidimensional parametric band-gap simultons

Multidimensional spatiotemporal parametric simultons (simultaneous solitary waves) are possible in a nonlinear chi((2)) medium with a Bragg grating structure, where large effective dispersion occurs near two resonant band gaps for the carrier and second-harmonic field, respectively. The enhanced dispersion allows much reduced interaction lengths, as compared to bulk medium parametric simultons. The nonlinear parametric band-gap medium permits higher-dimensional stationary waves to form. In addition, solitons can occur with lower input powers than conventional nonlinear Schrodinger equation gap solitons. In this paper, the equations for electromagnetic propagation in a grating structure with a parametric nonlinearity are derived from Maxwell's equation using a coupled mode Hamiltonian analysis in one, two, and three spatial dimensions. Simultaneous solitary wave solutions are proved to exist by reducing the equations to the coupled equations describing a nonlinear parametric waveguide, using the effective-mass approximation (EMA). Exact one-dimensional numerical solutions in agreement with the EMA solutions are also given. Direct numerical simulations show that the solutions have similar types of stability properties to the bulk case, providing the carrier waves are tuned to the two Bragg resonances, and the pulses have a width in frequency space less than the band gap. In summary, these equations describe a physically accessible localized nonlinear wave that is stable in up to 3 + 1 dimensions. Possible applications include photonic logic and switching devices. [S1063-651X(98)06109-1].

The currency of case management: benefits and costs

Case management models evolved as the mental health care system shifted hospital to community settings. The research evidence underscores the efficacy of certain case management models under 'ideal' conditions; what is less clear, is how these models perform in day to day clinical practice. Moreover, the economic perspective adopted by most studies is relatively narrow thus limiting a proper understanding of the costs and benefits of such models. This paper reviews recent work in the field and highlights gaps in both method and application as a focus for future work. Curr Opin Psychiatry 12:195-199, (C) 1999 Lippincott Williams & Wilkins.

The N-15 natural abundance (delta N-15) of ecosystem samples reflects measures of water availability

We assembled a globally-derived data set for site-averaged foliar delta(15)N, the delta(15)N of whole surface mineral soil and corresponding site factors (mean annual rainfall and temperature, latitude, altitude and soil pH). The delta(15)N of whole soil was related to all of the site variables (including foliar delta(15)N) except altitude and, when regressed on latitude and rainfall, provided the best model of these data, accounting for 49% of the variation in whole soil delta(15)N. As single linear regressions, site-averaged foliar delta(15)N was more strongly related to rainfall than was whole soil delta(15)N. A smaller data set showed similar, negative correlations between whole soil delta(15)N, site-averaged foliar delta(15)N and soil moisture variations during a single growing season. The negative correlation between water availability (measured here by rainfall and temperature) and soil or plant delta(15)N fails at the landscape scale, where wet spots are delta(15)N-enriched relative to their drier surroundings. Here we present global and seasonal data, postulate a proximate mechanism for the overall relationship between water availability and ecosystem delta(15)N and, newly, a mechanism accounting for the highly delta(15)N-depleted values found in the foliage and soils of many wet/cold ecosystems. These hypotheses are complemented by documentation of the present gaps in knowledge, suggesting lines of research which will provide new insights into terrestrial N-cycling. Our conclusions are consistent with those of Austin and Vitousek (1998) that foliar (and soil) delta(15)N appear to be related to the residence time of whole ecosystem N.

The perception of Executives and other Employees on the answer to the Sarbanes-Oxley: case study of a subsidary of the American auto industry established in Brazil

To attend and obtain the systems and. internal controls mechanisms proposed by Sarbanes-Oxley certifications is actually a big challenge,for most of the multinational companies registered in SEC (US Securities and Exchange Commission). This work has the objective of contributing to the analysis of this methodology, not only to attend the law but to reduce cost and generate value through the strengthen of the internal control systems, turning them into animating value generation process mechanisms. So, the idea is to identify the main gaps in the theory through the literature revision and a case study in order to put a question to the main deficiencies, strong points or contributions through the evaluation of the noticed practices. Finally, we can say that a a result of the research and the analyses made in. this case, the vast majority of executives and other employees recognize the benefit that Sarbanes-Oxley Act has brought to the company searched. Also recognize that, although there is still necessity for systemic adequacy and infrastructure, it helps and reinforce reducing and controlling the risks. the system of internal controls in all areas of expertise. They approach and understand that there is the need for a change in the other employees` culture to be inserted in the day-today routine as internal controls, attention to Sarbanes-Oxley and Corporate Governance, making the control cost smaller when compared to the benefits generated.

Preventing recurrent events long term after coronary artery bypass graft: Suboptimal use of medications in a population study

Background There are few population-based data on long-term management of patients after coronary artery bypass graft (CABG), despite the high risk for future major vascular events among this group. We assessed the prevalence and correlates of pharmacotherapy for prevention of new cardiac events in a large population-based series. Methods A postal survey was conducted of 2500 randomly selected survivors from a state population of patients 6 to 20 years after first CABG. Results Response was 82% (n = 2061). Use of antiplatelet agents (80%) and statins (64%) declined as age increased. Other independent predictors of antiplatelet use included statin use (odds ratio [OR] 1.6, 95% CI 1.26-2.05) and recurrent angina (OR 1.6, CI 1.17-2.06). Current smokers were less likely to use aspirin (OR 0.59, CI 0.4-0.89). Statin use was associated with reported high cholesterol (OR 24.4, CI 8.4-32.4), management by a cardiologist (OR 2.3, CI 1.8-3.0), and the use of calcium channel-blockers. Patients reporting hypertension or heart failure, in addition to high cholesterol, were less likely to use statins. Angiotensin-converting enzyme inhibitors were the most commonly prescribed agents for management of hypertension (59%) and were more frequently used among patients with diabetes and those with symptoms of heart failure. Overall 42% of patients were on angiotensin-converting enzyme inhibitors and 36% on beta-blockers. Conclusions Gaps exist in the use of-recommended medications after CABG. Lower anti-platelet and statin use was associated with older age, freedom from angina, comorbid heart failure or hypertension, and not regularly visiting a cardiologist. Patients who continue to smoke might be less likely to adhere to prescribed medications.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

The Strength of Weak Parties

The Strength of Weak Parties The aim of this article is to fill some gaps in research on the Brazilian electoral arena. The current literature, by neglecting the study of party organization, ends up overlooking fundamental questions for understanding how the electoral process works. This study addressed two questions: How do Brazilian parties work? What is the impact of party organization on a party`s decision to launch or withhold a candidate in a given election? We intend to show that the parties have more life than many studies on our political system tend to show. This partisan life helps understand one of the central aspects of the electoral arena, that is, how pre-election coordination occurs.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Influence of Cochlear Function on Auditory Temporal Resolution in Tinnitus Patients

Our aim was to analyze the influence of subtle cochlear damage on temporal auditory resolution in tinnitus patients. Forty-eight subjects (hearing threshold <= 25 dB HL) were assigned to one of two experimental groups: 28 without auditory complaints (mean age, 28.8 years) and 20 with tinnitus (mean age, 33.5 years). We analyzed distortion product otoacoustic emission growth functions (by threshold, slope, and estimated amplitude), extended high-frequency thresholds, and the Gaps-in-Noise test. There were differences between the groups, principally in the extended high-frequency thresholds and the Gaps-in-Noise test results. Our findings suggest that subtle peripheral hearing impairment affects temporal resolution in tinnitus, even when pure-tone thresholds as conventionally measured appear normal. Copyright (C) 2010 S. Karger AG, Basel

Nasal allergies in the Latin American population: Results from the Allergies in Latin America survey

Allergies in Latin America is the first cross-national survey that describes the symptoms, impact, and treatment of nasal allergies (NAs) in individuals >= 4 years old in Latin America (LA). In total, 22,012 households across the Latin American countries of Argentina, Brazil, Chile, Colombia, Ecuador, Mexico, Peru, and Venezuela were screened for children, adolescents, and adults with a diagnosis of NA and either symptoms or treatment in the past 12 months. A total of 1088 adults and 457 children and adolescents were included and the sample was probability based to ensure valid statistical inference to the population. Approximately 7% of the LA population was diagnosed with NAs with two of three respondents stating that their allergies were seasonal or intermittent in nature. A general practice physician or otolaryngologist diagnosed the majority of individuals surveyed. Nasal congestion was the most common and bothersome symptom of NAs. Sufferers indicated that their symptoms affected productivity and sleep and had a negative impact on quality of life. Two-thirds of patients reported taking some type of medication for their NAs, with a roughly equal percentage of patients reporting taking over-the-counter versus prescription medications. Changing medications was most commonly done in those reporting inadequate efficacy. The most common reasons cited for dissatisfaction with current medications were related to inadequate effectiveness, effectiveness wearing off with chronic use, failure to provide 24-hour relief, and bothersome side effects (e.g., unpleasant taste and retrograde drainage into the esophagus). Findings from this cross-national survey on NAs have confirmed a high prevalence of physician-diagnosed NAs and a considerable negative impact on daily quality of life and work productivity as well as substantial disease management challenges in LA. Through identification of disease impact on the LA population and further defining treatment gaps, clinicians in LA may better understand and treat NAs, thus leading to improvements in overall patient satisfaction and quality of life. (Allergy Asthma Proc 31:S9-S27, 2010; doi: 10.2500/aap.2010.31.3347)

LOW-INTENSITY ULTRASOUND APPLICATION IN DISTAL RADIUS METAPHYSEAL BONE DEFECTS OF DOGS

We assessed the repair of transverse, 3-mm wide bone gaps created at the distal radius in 28 dogs that were randomly divided into two 14-animal groups; one was the control group and the other received a daily, 20-min application of low-intensity pulsed ultrasound for 100 days. Sequential radiographs, histomorphometrics, bone fluorescent histology and bone vascularity assessments found that all animals from both groups obtained a stage of hypertrophic-type nonunion with fibrocartilage tissue formation throughout the region of osteotomy. However, treated animals exhibited areas of endochondral ossification within the fibrocartilage region. There was no difference in type of vascularity or the newly formed bone process obtained by tetracycline labeling. Application of low-intensity ultrasound was not capable of significantly changing the reparative process and it may not be sufficiently powerful to overcome a combination of local deleterious effects on bone healing, created by gapping, excessive motion and periosteal resection. (E-mail: jbvolpon@fmrp.usp.br) (C) 2010 World Federation for Ultrasound in Medicine & Biology.

Composite pre-heating: Effects on marginal adaptation, degree of conversion and mechanical properties

Objectives. This study evaluated the effect of composite pre-polymerization temperature and energy density on the marginal adaptation (MA), degree of conversion (DC), flexural strength (FS), and polymer cross-linking (PCL) of a resin composite (Filtek Z350, 3M/ESPE). Methods. For MA, class V cavities (4mmx2mmx2mm) were prepared in 40 bovine incisors. The adhesive system Adper Single Bond 2 (3M/ESPE) was applied. Before being placed in the cavities, the resin composite was either kept at room-temperature (25 degrees C) or previously pre-heated to 68 degrees C in the Calset (TM) device (AdDent Inc., Danbury, CT, USA). The composite was then light polymerized for 20 or 40s at 600mW/cm(2) (12 or 24 J/cm(2), respectively). The percentage of gaps was analyzed by scanning electron microscopy, after sectioning the restorations and preparing epoxy resin replicas. DC (n = 3) was obtained by FT-Raman spectroscopy on irradiated and non-irradiated composite surfaces. FS (n = 10) was measured by the three-point-bending test. KHN (n = 6) was measured after 24h dry storage and again after immersion in 100% ethanol solution for 24 h, to calculate PCL density. Data were analyzed by appropriate statistical analyses. Results. The pre-heated composite showed better MA than the room-temperature groups. A higher number of gaps were observed in the room-temperature groups, irrespective of the energy density, mainly in the axial wall (p < 0.05). Composite pre-heating and energy density did not affect the DC, FS and PCL (p > 0.05). Significance. Pre-heating the composite prior to light polymerization similar in a clinical situation did not alter the mechanical properties and monomer conversion of the composite, but provided enhanced composite adaptation to cavity walls. (C) 2010 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

Physical Properties and Interfacial Adaptation of Three Epoxy Resin-based Sealers

Introduction: The aim of the study was to evaluate the radiopacity, solubility, flow, film thickness, setting time, and adaptation to the root canal walls of 3 epoxy resin based sealers: AH Plus, Acroseal, and Adseal. Methods: Physical tests were performed following American National Standards Institute/American Dental Association`s requirements. For interfacial adaptation analysis, 30 maxillary canines were shaped by using Pro Taper instruments. The specimens were divided into 3 groups (n = 10): group 1, AH Plus; group 2, Acroseal; and group 3, Adseal. The sealers were mixed with rhodamine B dye, and the canals were filled by using the lateral compaction technique. The percentage of gaps and voids area was calculated at 2, 4, and 6 mm levels from the apex. Statistical evaluation was performed by using analysis of variance for physical analysis and nonparametric Kruskal-Wallis and Dunn tests for interfacial adaptation (P<.05). Results: No statistical differences were found for adaptation, percentage of voids, solubility, flow, and film thickness among the sealers (P>.05). AH Plus was significantly more radiopaque (P<.05). For the setting time, there were statistical differences among all the studied sealers (P<.05). Conclusions: AH Plus, Acroseal, and Adseal presented similar root canal adaptation, solubility, flow, and film thickness. Statistical differences were found for radiopacity and setting time (P<.05). (J Endod 2011;37:1417-1421)

The effects of occlusal loading on the margins of cervical restorations

Background. Researchers have proposed the restoration of abfraction lesions, but limited information is available about the effects of occlusal loading on the margins of such restorations. Because abfraction is a well-recognized problem, the authors conducted a study to assess the effects of occlusal loading on the margins of cervical restorations. Methods. The authors prepared 40 wedge-shaped cavities in extracted premolars and restored them with a resin-based composite. They subjected specimens to occlusal loading (150 newtons, 101 cycles) on the buccal cusp, on the central fossa or on the lingual cusp, and they stored 1 the control group, specimens in deionized water. The authors used fluorescein to delimit marginal defects and evaluated the defects by using laser scanning confocal microscopy. Results. Results of chi(2) and Kruskal-Wallis tests (P < .05) showed that specimens subjected to occlusal loading had a higher percentage of marginal gaps (53.3 percent) than did the control specimens (10.0 percent). There were no differences between groups in marginal defect formation or in defect location, length or width. Conclusions. Occlusal loading led to a significant increase in gap formation at the margins of cervical resin-based composite restorations. Clinical Implications. The clinician cannot underestimate the effects of occlusal loading When restoring teeth with cervical wedge-shaped lesions. If occlusal loading is the main factor contributing to lesion formation, the clinician should identify and treat it before placing the restoration or otherwise run the risk that the restorative treatment will fail because of marginal gap formation.