797 resultados para SUGAR-RICH FOODS


Relevância:

20.00% 20.00%

Publicador:

Resumo:

A modelling framework is developed to determine the joint economic and environmental net benefits of alternative land allocation strategies. Estimates of community preferences for preservation of natural land, derived from a choice modelling study, are used as input to a model of agricultural production in an optimisation framework. The trade-offs between agricultural production and environmental protection are analysed using the sugar industry of the Herbert River district of north Queensland as an example. Spatially-differentiated resource attributes and the opportunity costs of natural land determine the optimal tradeoffs between production and conservation for a range of sugar prices.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Las Campanas Observatory and Anglo-Australian Telescope Rich Cluster Survey (LARCS) is a panoramic imaging and spectroscopic survey of an X-ray luminosity-selected sample of 21 clusters of galaxies at 0.07 < z < 0.16. Charge-coupled device (CCD) imaging was obtained in B and R of typically 2 degrees wide regions centred on the 21 clusters, and the galaxy sample selected from the imaging is being used for an on-going spectroscopic survey of the clusters with the 2dF spectrograph on the Anglo-Australian Telescope. This paper presents the reduction of the imaging data and the photometric analysis used in the survey. Based on an overlapping area of 12.3 deg(2) we compare the CCD-based LARCS catalogue with the photographic-based galaxy catalogue used for the input to the 2dF Galaxy Redshift Survey (2dFGRS) from the APM, to the completeness of the GRS/APM catalogue, b(J) = 19.45. This comparison confirms the reliability of the photometry across our mosaics and between the clusters in our survey. This comparison also provides useful information concerning the properties of the GRS/APM. The stellar contamination in the GRS/APM galaxy catalogue is confirmed as around 5-10 per cent, as originally estimated. However, using the superior sensitivity and spatial resolution in the LARCS survey evidence is found for four distinct populations of galaxies that are systematically omitted from the GRS/APM catalogue. The characteristics of the 'missing' galaxy populations are described, reasons for their absence examined and the impact they will have on the conclusions drawn from the 2dF Galaxy Redshift Survey are discussed.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present a photometric investigation of the variation in galaxy colour with environment in 11 X-ray-luminous clusters at 0.07 less than or equal to z less than or equal to 0.16 taken from the Las Campanas/AAT Rich Cluster Survey. We study the properties of the galaxy populations in individual clusters, and take advantage of the homogeneity of the sample to combine the clusters together to investigate weaker trends in the composite sample. We find that modal colours of galaxies lying on the colour-magnitude relation in the clusters become bluer by d(B - R)/dr(p) = -0.022 +/- 0.004 from the cluster core out to a projected radius of r(p) = 6 Mpc, further out in radius than any previous study. We also examine the variation in modal galaxy colour with local galaxy density, 2, for galaxies lying close to the colour-magnitude relation, and find that the median colour shifts bluewards by d(B - R)/d log(10)(Sigma) = -0.076 +/- 0.009 with decreasing local density across three orders of magnitude. We show that the position of the red envelope of galaxies in the colour-magnitude relation does not vary as a function of projected radius or density within the clusters, suggesting that the change in the modal colour results from an increasing fraction of bluer galaxies within the colour-magnitude relation, rather than a change in the colours of the whole population. We show that this shift in the colour-magnitude relations with projected radius and local density is greater than that expected from the changing morphological mix based on the local morphology-density relation. We therefore conclude that we are seeing a real change in the properties of galaxies on the colour-magnitude relation in the outskirts of clusters. The simplest interpretation of this result (and similar constraints in local clusters) is that an increasing fraction of galaxies in the lower density regions at large radii within clusters exhibit signatures of star formation in the recent past, signatures which are not seen in the evolved galaxies in the highest density regions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Monosaccharides provide an excellent platform to tailor molecular diversity by appending desired substituents at selected positions around the sugar scaffold. The presence of five functionalized and stereo-controlled centres on the sugar scaffolds gives the chemist plenty of scope to custom design molecules to a pharmacophore model. This review focuses on the peptidomimetic developments in this area, as well as the concept of tailoring structural and functional diversity in a library using carbohydrate scaffolds and how this can lead to increased hit rates and rapid identification of leads, which has promising prospects for drug development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Brazil consolidated itself as the largest world producer of sugarcane, sugar and ethanol. The creation of the Programa Nacional do Alcool - PROALCOOL and the growing use of cars with flexible motors were some of the factors that helped to motivate still more the production. Evolutions in the agricultural and industrial research did the Brazilian competitiveness in sugar and ethanol globally elevated, what is evidenced when comparing the amount produced at the country and the production costs, which turned a big one differential. Therefore, the administration of costs is of great relevance to the sugar and ethanol companies, for representing a significant rationalization in the production processes, with economy of resources and the reach of better earnings, besides reducing the operational risk pertinent at the fixed costs of production. Thus, the present work has for objective to analyze the costs structure of sugar and ethanol companies of the Center-south area of the country through an empiric-analytical study based in methodologies and concepts extracted of the costs accounting. It is verified that great part of the costs and operational expenses have variable behavior, a positive factor for the sector reducing the operational risk of the activity. The main restraint of this study is the sample of five years and 10% of the number of plants in Brazil that although they represent 30% of the national production, don`t allow the generalization of the model.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work reports on rainwater dissolved organic carbon (DOC) from Ribeirao Preto (RP) and Araraquara over a period of 3 years. The economies of these two cities, located in Sao Paulo state (Brazil), are based on agriculture and related industries, and the region is strongly impacted by the burning of sugar cane foliage before harvesting. Highest DOC concentrations were obtained when air masses traversed sugar cane fields burned on the same day as the rain event. Significant increases in the DOC volume weighted means (VWM) during the harvest period, for both sites, and a good linear correlation (r=0.83) between DOC and K (a biomass burning marker) suggest that regional scale organic carbon emissions prevail over long-range transport. The DOC VWMs and standard deviations were 272 +/- 22 mu mol L-1 (n=193) and 338 +/- 40 mu mol L-1 (n=80) for RP and Araraquara, respectively, values which are at least two times higher than those reported for other regions influenced by biomass burning, such as the Amazon. These high DOC levels are discussed in terms of agricultural activities, particularly the large usage of biogenic fuels in Brazil, as well as the analytical method used in this work, which includes volatile organic carbon when reporting DOC values. Taking into account rainfall volume, estimated annual rainwater DOC fluxes for RP (4.8 g C m(-2) yr(-1)) and Araraquara (5.4 g C m(-2) yr(-1)) were close to that previously found for the Amazon region (4.8 g C m(-2) yr(-1)). This work also discusses whether previous calculations of the global rainwater carbon flux may have been underestimated, since they did not consider large inputs from biomass combustion sources, and suffered from a possible analytical bias. (c) 2008 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article addresses the interactions of the synthetic antimicrobial peptide dermaseptin 01 (GLWSTIKQKGKEAAIAAA-KAAGQAALGAL-NH(2), DS 01) with phospholipid (PL) monolayers comprising (i) a lipid-rich extract of Leishmania amazonensis (LRE-La), (ii) zwitterionic PL (dipalmitoylphosphatidylcholine, DPPC), and (iii) negatively charged PL (dipalmitoylphosphatidylglycerol, DPPG). The degree of interaction of DS 01 with the different biomembrane models was quantified from equilibrium and dynamic liquid-air interface parameters. At low peptide concentrations, interactions between DS 01 and zwitterionic PL, as well as with the LRE-La monolayers were very weak, whereas with negatively charged PLs the interactions were stronger. For peptide concentrations above 1 mu g/ml, a considerable expansion of negatively charged monolayers occurred. In the case of DPPC, it was possible to return to the original lipid area in the condensed phase, suggesting that the peptide was expelled from the monolayer. However, in the case of DPPG, the average area per lipid molecule in the presence of DS 01 was higher than pure PLs even at high surface pressures, suggesting that at least part of DS 01 remained incorporated in the monolayer. For the LRE-La monolayers, DS 01 also remained in the monolayer. This is the first report on the antiparasitic activity of AMPs using Langmuir monolayers of a natural lipid extract from L. amazonensis. Copyright (C) 2011 European Peptide Society and John Wiley & Sons, Ltd.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Refractory gastroesophageal reflux disease (GERD) can be related to greater sensitization to foods. Objective: To evaluate sensitization to foods in patients with refractory GERD. Methods: Patients with refractory GERD after using at least 40 mg of a proton pump inhibitor were given a restriction diet based on the results of skin prick testing and atopy patch testing with foods. The characteristics of sensitized patients were compared with those of nonsensitized patients in relation to atopy and number of eosinophils in the esophageal mucosa. Results: The prevalence of sensitization to foods was 27.7%. Asthmatic patients showed higher sensitization to foods (P = .008). Eosinophils were determined to be present in the esophageal mucosa in 15.8% of patients, and this correlated with greater sensitization to foods (P = .01). One case of eosinophilic esophagitis was confirmed. A diet excluding identified sensitizing foods led to clinical improvement regarding GERD symptoms (P = .004). Conclusion: The presence of eosinophils in esophageal mucosa associated with greater sensitization to foods and the response to a restriction diet in patients with positive test results suggest that refractory GERD can represent an initial stage of eosinophilic esophagitis. Ann Allergy Asthma Immunol. 2010;105:359-363.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Albicidins, a family of phytotoxins and antibiotics produced by Xanthomonas albilineans, are important in sugar cane leaf scald disease development. The albicidin detoxifying bacterium Pantoea dispersa (syn. Erwinia herbicola) SB1403 provides very effective biocontrol against leaf scald disease in highly susceptible sugar cane cultivars. The P. dispersa gene (albD) for enzymatic detoxification of albicidin has recently been cloned and sequenced. To test the role of albicidin detoxification in biocontrol of leaf scald disease, albD was inactivated in P. dispersa by site-directed mutagenesis. The mutants, which were unable to detoxify albicidin, were less resistant to the toxin and less effective in biocontrol of leaf scald disease than their parent strain. This indicates that albicidin detoxification contributes to the biocontrol capacity of P. dispersa against X. albilineans. Rapid growth and ability to acidify media are other characteristics likely to contribute to the competitiveness of P. dispersa against X. albilineans at wound sites used to invade sugar cane.