Earthworms produce granules of intricately zoned calcite

Earthworms of the family Lumbricidae, which includes many common species, produce and secrete up to millimeter-sized calcite granules, and the intricate fine-scale zoning of their constituent crystals is unique for a biomineral. Granule calcite is produced by crystallization of amorphous calcium carbonate (ACC) that initially precipitates within the earthworm calciferous glands, then forms protogranules by accretion on quartz grain cores. Crystallization of ACC is mediated by migrating fluid films and is largely complete within 24 11 of ACC production and before granules leave the earthworm. Variations in the density of defects formed as a byproduct of trace element incorporation during calcite crystall growth have generated zoning that can be resolved by cathodoluminescence imaging at ultraviolet to blue wavelengths and using the novel technique of scanning electron microscope charge contrast imaging. Mapping of calcite crystal orientations by electron backscatter diffraction reveals an approximate radial fabric to the granules that reflects crystal growth from internal nucleation sites toward their margins. The survival within granules of ACC inclusions for months after they enter soils indicates that they crystallize only within the earthworm and in the presence of fluids containing biochemical catalysts. The earthworm probably promotes crystallization of ACC in order to prevent remobilization of the calcium carbonate by dissolution. Calcite granules vividly illustrate the role of transient precursors in biomineralization, but the underlying question of why earth-worms produce granules in volumes sufficient to have a measurable impact on soil carbon cycling remains to be answered.

Doppler lidar measurements of oriented planar ice crystals falling from supercooled and glaciated layer clouds

The properties of planar ice crystals settling horizontally have been investigated using a vertically pointing Doppler lidar. Strong specular reflections were observed from their oriented basal facets, identified by comparison with a second lidar pointing 4° from zenith. Analysis of 17 months of continuous high-resolution observations reveals that these pristine crystals are frequently observed in ice falling from mid-level mixed-phase layer clouds (85% of the time for layers at −15 °C). Detailed analysis of a case study indicates that the crystals are nucleated and grow rapidly within the supercooled layer, then fall out, forming well-defined layers of specular reflection. From the lidar alone the fraction of oriented crystals cannot be quantified, but polarimetric radar measurements confirmed that a substantial fraction of the crystal population was well oriented. As the crystals fall into subsaturated air, specular reflection is observed to switch off as the crystal faces become rounded and lose their faceted structure. Specular reflection in ice falling from supercooled layers colder than −22 °C was also observed, but this was much less pronounced than at warmer temperatures: we suggest that in cold clouds it is the small droplets in the distribution that freeze into plates and produce specular reflection, whilst larger droplets freeze into complex polycrystals. The lidar Doppler measurements show that typical fall speeds for the oriented crystals are ≈ 0.3 m s−1, with a weak temperature correlation; the corresponding Reynolds number is Re ∼ 10, in agreement with light-pillar measurements. Coincident Doppler radar observations show no correlation between the specular enhancement and the eddy dissipation rate, indicating that turbulence does not control crystal orientation in these clouds. Copyright © 2010 Royal Meteorological Society

The photodimerisation of the alpha- and beta-forms of trans-cinnamic acid: a study of single crystals by vibrational microspectroscopy

Infrared and Raman microspectroscopy have been used to follow the photodimerisation reactions of single crystals, the alpha- and beta-forms of trans-cinnamic acid. This approach allows the starting materials and products -alpha-truxillic acid that has C-i symmetry and beta-truxinic acid, which has C-s symmetry-to be identified. It also allows the topotactic nature of the reaction to be confirmed. Attempts to produce the poorly-defined unreactive gamma-form of trans-cinnamic acid resulted only in a mixture of the alpha- and beta-forms. The findings suggest a wide role for these spectroscopic methods in monitoring solid-state organic reactions. (C) 2002 Elsevier Science B.V. All rights reserved.

Stepwise self-assembly of a tripeptide from molecular dimers to supramolecular beta-sheets in crystals and amyloid-like fibrils in the solid state

The terminally protected tripeptide Boc-Ala(1)-Leu(2)-Ala(3)-OMe 1 forms antiparallel hydrogen-bonded dimers of two different conformers in the asymmetric unit and the individual dimers then self-associate to form supramolecular beta-sheet structures in crystals and amyloid-like fibrils in the solid state.

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

The chemistry of intrinsically chiral surfaces

Intrinsically chiral metal and mineral surfaces show enantioselective behaviour without modifiers. Examples are artificial high-Miller-index surfaces of metal single crystals with cubic bulk lattice symmetry, which have no mirror planes and are therefore chiral, or surfaces of naturally occurring crystallites of some common minerals, such as alpha-quartz or calcite. Recent findings with regards to the surface geometry, reactivity and thermal stability of intrinsically chiral surfaces are discussed. A number of enantioselective effects have been reported in connection with the adsorption of small chiral molecules (e.g. alanine, cysteine) on intrinsically chiral surfaces under well-defined conditions. From a combination of experimental surface science techniques and theoretical ab initio model calculations it emerges that these effects are due to a combination of attractive and repulsive adsorbate-substrate and inter-adsorbate interactions.

Gas-solid reactions of single crystals: a study of reactions of NH3 and NO2 with single crystalline organic substrates by infrared microspectroscopy

Reaction of single crystals of benzoic and trans-cinnamic acids with 200 Torr pressure of ammonia gas in a sealed glass bulb at 20 degrees C generates the corresponding ammonium salts; there is no sign of any 1:2 adduct as has been reported previously for related systems. Isotopic substitution using ND3 has been used to aid identification of the products. Adipic acid likewise reacts with NH3 gas to form a product in which ammonium salts are formed at both carboxylic acid groups. Reaction of 0.5 Torr pressure of NO2 gas with single crystals of 9-methylanthracene and 9-anthracenemethanol in a flow system generates nitrated products where the nitro group appears to be attached at the 10-position, i.e. the position trans to the methyl or methoxy substituent on the central ring. Isotopic substitution using (NO2)-N-15 has been used to confirm the identity of the bands arising from the coordinated NO2 group. The products formed when single crystals of hydantoin are reacted with NO2 gas under similar conditions depend on the temperature of the reaction. At 20 degrees C, a nitrated product is formed, but at 65 degrees C this gives way to a product containing no nitro groups. The findings show the general applicability of infrared microspectroscopy to a study of gas-solid reactions of organic single crystals. (c) 2005 Elsevier B.V. All rights reserved.

Gas-solid reactions of single crystals: a study of the reaction of bromine with single crystals of trans-cinnamic acid and a range of its derivatives by infrared and Raman microspectroscopy

Single crystals of trans-cinnamic acid and of a range of derivatives of this compound containing halogen substituents on the aromatic ring have been reacted with 165 Torr pressure of bromine vapour in a sealed desiccator at 20 degrees C for 1 week. Infrared and Raman microspectroscopic examination of the crystals shows that bromination of the aliphatic double bond, but not of the aromatic ring, has occurred. It is demonstrated also that the reaction is truly gas-solid in nature. A time-dependent study of these reactions shows that they do not follow a smooth diffusion-controlled pathway. Rather the reactions appear to be inhomogeneous and to occur at defects within the crystal. The reaction products are seen to flake from the surface of the crystal. It is shown, therefore, that these are not single crystal to single crystal transitions, as have been observed previously for the photodimerisation of trans-cinnamic acid and several of its derivatives. It is shown that there are no by-products of the reaction and that finely ground samples react to form the same products as single crystals.

Quartz crystal microbalance monitoring of density changes in mesoporous TiO2 phytate films during redox and ion exchange processes

Nanofilm deposits of TiO2 nanoparticle phytates are formed on gold electrode surfaces by 'directed assembly' methods. Alternate exposure of a 3-mercapto-propionic acid modified gold surface to (i) a TiO2 sol and (ii) an aqueous phytic acid solution (pH 3) results in layer-by-layer formation of a mesoporous film. Ru(NH3)(6)(3+) is shown to strongly adsorb/accumulate into the mesoporous structure whilst remaining electrochemically active. Scanning the electrode potential into a sufficiently negative potential range allows the Ru(NH3)(6)(3+) complex to be reduced to Ru(NH3)(6)(2+) which undergoes immediate desorption. When applied to a gold coated quartz crystal microbalance (QCM) sensor, electrochemically driven adsorption and desorption processes in the mesoporous structure become directly detectable as a frequency response, which corresponds directly to a mass or density change in the membrane. The frequency response (at least for thin films) is proportional to the thickness of the mass-responsive film, which suggests good mechanical coupling between electrode and film. Based on this observation, a method for the amplified QCM detection of small mass/density changes is proposed by conducting measurements in rigid mesoporous structures. (C) 2003 Elsevier Science B.V. All rights reserved.

Detection of polycyclic aromatic hydrocarbons using quartz crystal microbalances

A chemically coated piezoelectric sensor has been developed for the determination of PAHs in the liquid phase. An organic monolayer attached to the surface of a gold electrode of a quartz crystal microbalance (QCM) via a covalent thiol-gold link complete with an ionically bound recognition element has been produced. This study has employed the PAH derivative 9-anthracene carboxylic acid which, once bound to the alkane thiol, functions as the recognition element. Binding of anthracene via pi-pi interaction has been observed as a frequency shift in the QCM with a detectability of the target analyte of 2 ppb and a response range of 0-50 ppb. The relative response of the sensor altered for different PAHs despite pi-pi interaction being the sole communication between recognition element and analyte. It is envisaged that such a sensor could be employed in the identification of key marker compounds and, as such, give an indication of total PAH flux in the environment.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.