Structure and rheology of aqueous micellar solutions and gels formed from an associative poly(oxybutylene)-poly(oxyethylene)-poly(oxybutylene) triblock copolymer

The structure and shear flow behaviour of aqueous micellar solutions and gels formed by an amphiphilic poly(oxybutylene)-poly(oxyethylene)-poly(oxybutylene) triblock copolymer with a lengthy hydrophilic poly(oxyethylene) block has been investigated by rheology, small angle neutron scattering (SANS) and small-angle X-ray scattering (SAXS). SANS revealed that bridging of chains between micelles introduces, in the micellar solution, an attractive long-range component which can be described through a potential of interaction corresponding to sticky soft spheres. The strength of the attractive interaction increases with increasing concentration. Rheology showed that the dependence of the storage modulus with temperature can be explained as a function of the micellar bridging, micellisation and phase morphology. SAXS studies showed that the orientation adopted by the system in the get phase under shear is similar to that previously observed by us for the gel phase of a poly(oxyethylene)-poly(oxybutylene) diblock copolymer with a long poly(oxyethylene) chain, suggesting that the micellar corona/core length ratio and not the architecture of the block copolymer influences the alignment of the gel phase under shear.

Pressure effects revealed by small angle neutron scattering on block copolymer gels

We study the effects of hydrostatic pressure (P) on aqueous solutions and gels of the block copolymer B20E610 (E, oxyethylene; B, oxybutylene; subscripts, number of repeats), by performing simultaneous small angle neutron scattering/pressure experiments. Micellar cubic gels were studied for 9.5 and 4.5 wt% B20E610 at T = 20-80 and 35-55 degrees C, respectively, while micellar isotropic solutions where Studied for 4.5 wt% B20E610 at T > 55 degrees C. We observed that the interplanar distance d(110) (cubic unit cell parameter a = root 2d(110)) decreases while the correlation length of the Cubic order (delta) increases, upon increasing P at a fixed T for 9.5 wt% B20E610. The construction of master Curves for d(110) and delta corresponding to 9.5 wt% B20E610 proved the correlation between changes in T and P. Neither d(110) and delta nor the cubic-isotropic phase transition temperature was affected by the applied pressure for 4.5 wt% B20E610. The dramatic contrast between the pressure-induced behavior observed for 9.5 and 4.5 wt% B20E610 suggests that pressure induced effects might be more effectively transmitted through samples that present wider domains of cubic structure order (9.5 wt% compared to 4.5 wt% B20E610).

Synthesis, structure and magnetic characterisation of a new layered ammonium manganese(II) diphosphate hydrate, (NH4)(2)[Mn-3(P2O7)(2)(H2O)(2)]

A new layered ammonium manganese(II) diphosphate, (NH4)(2)[Mn-3(P2O7)(2)(H2O)(2)], has been synthesised under solvothermal conditions at 433 K in ethylene glycol and the structure determined at 293 K using single-crystal X-ray diffraction data (M-r = 584.82, monoclinic, space group P2(1)/a, a = 9.4610( 8), b = 8.3565( 7), c = 9.477(1) Angstrom, beta = 99.908(9) degrees, V = 738.07 Angstrom(3), Z = 2, R = 0.0351 and R-w = 0.0411 for 1262 observed data (I > 3(sigma(I))). The structure consists of chains of cis- and trans-edge sharing MnO6 octahedra linked via P2O7 units to form layers of formula [Mn3P4O14(H2O)(2)](2-) in the ab plane. Ammonium ions lie between the manganese-diphosphate layers. A network of interlayer and ammonium-layer based hydrogen bonding holds the structure together. Magnetic measurements indicate Curie - Weiss behaviour above 30 K with mu(eff) = 5.74(1) mu(B) and theta = -23(1) K, consistent with the presence of high-spin Mn2+ ions and antiferromagnetic interactions. However, the magnetic data reveal a spontaneous magnetisation at 5 K, indicating a canting of Mn2+ moments in the antiferromagnetic ground state. On heating (NH4)(2)[Mn-3(P2O7)(2)(H2O)(2)] in water at 433 K under hydrothermal conditions, Mn-5(HPO4)(2)(PO4)(2).4H(2)O, synthetic hureaulite, is formed.

Ruthenium (III) complexes of tetradentate NSNO pyridylthioazophenolates: Synthesis, spectral studies, crystal structure and redox properties

A family of ruthenium (III) complexes of tetradentate monobasic NSNO donor chelators (HL) have been synthesized and isolated in their pure form. On chromatographic separation, trans-dichloro and cis-dichloro ruthenium (111) complexes of pyridylthioazophenolates are eluted using 19:1 and 7:3 (v/v) DCM-MeOH mixtures, respectively. Both cis and trans isomers of the dark brown colored ruthenium (111) complexes, having the general formula of [Ru(L)Cl-2], have been characterized by elemental analyses, spectroscopic and other physico-chemical tools. The magnetic moments of both the cis- and trans-[Ru(L)Cl-2] complexes are in the range of 1.71-1.79 BM. One of the complexes, trans-[Ru(L1)Cl-2] (2a), has been subjected to single-crystal X-ray analysis which confirms that the chlorines are in mutually trans positions in the molecule. The EPR spectra of the cis-[Ru(L)Cl-2] complexes (1) in DMF are consistent with the fact that the complexes are low-spin octahedral with one unpaired electron having three different g values (g(x) not equal g(y) not equal g(z)) complexes are monomeric with an octahedral coordination sphere. The electrochemical studies of [Ru(L)Cl,] in DMF show a quasi-reversible voltammogram. The reduction potentials for the cis-isomers are comparatively lower than those of the corresponding trans isomers. On reaction with the bidentate bipyridyl ligand in the presence of AgNO3, the cis-[Ru(L)Cl-2] complexes (1) produce a series of complexes with the general formula [Ru(L)(bpy)(2)](PF6)(2) (3). which have also been characterized by elemental analyses, spectroscopic and other physico-chemical tools. (c) 2006 Elsevier Ltd. All rights reserved.

Structure, and thermal, magnetic and chemical properties of copper(II)iodoacetate monohydrate

Reaction of iodoacetic acid with cupric carbonate in water in dimmed light yields green Cu(ICH2COO)(2 center dot)H2O (1). From X-ray crystallography, it is found to be a tetra-acetato bridged copper(II) dimer with the water molecules occupying the apical positions. In thermogravimetry, the coordinated water molecules are lost in the temperature range 50-100 degrees C. From magnetic susceptibility measurements in the temperature range 300-1.8 K, the exchange coupling constant J is found to be -142(1) cm(-1) and g = 2.18(2) with the spin Hamiltonian H = -2J{S-Cu1 center dot S-Cu2}. It reacts with 2,2'-bipyridine (bpy) to yield [Cu(bpy)(2)I]I. It oxidises thiophenol to Ph-S-S-Ph under dry N-2 atmosphere.

Aperiodicity, structure, and dynamics in Ni(CN)(2)

By combining the results of both x-ray diffraction and neutron total-scattering experiments, we show that Ni(CN)(2) exhibits long-range structural order only in two dimensions, with no true periodicity perpendicular to its gridlike layers. Reverse Monte Carlo analysis gives an experimental distinction between M-C and M-N bond lengths in a homometallic cyanide framework and identifies the vibrational modes responsible for anomalous positive and negative thermal expansion in the title compound.

Synthesis, structure and properties of cobalt(II/III) seleno-bisphenolate complexes containing NN bidentate co-ligands: kinetic studies on the reduction of a cobalt(III) complex by ascorbic acid in 80% MeCN-20% water

Two cobalt complexes, [Co(L-Se)(phen)]center dot CH2Cl2 (1) and [Co(L-Se)(N,N-Me(2)en)(CH3COO-)] (2) have been synthesized and characterized by elemental analyses, magnetic measurements, i.r. studies etc. Single crystal X- ray studies reveal that in complex (1) cobalt atom is in +2 oxidation state with trigonal bipyramidal geometry, while in complex (2) it is in +3 oxidation state and surrounded octahedrally. The asymmetric unit of complex (2) contains two crystallographically independent discrete molecules. Complex (1) was found to be paramagnetic with mu(eff) = 2.19 BM indicating a low spin cobalt(II) d(7) system, whereas complex (2) is found to be diamagnetic with cobalt(III) in low spin d(6) state. The kinetic studies on the reduction of (2) by ascorbic acid in 80% MeCN-20% H2O (v/v) at 25 degrees C reveal that the reaction proceeds through the rapid formation of inner-sphere adduct, probably by replacing the loosely coordinated AcO- group, followed by electron transfer in a slow step and is supported by a large Q (formation constant) value.

Inelastic neutron scattering in spectroscopic studies of hydrogen on carbon-supported catalysts-experimental spectra and computed spectra of model systems

Inelastic neutron scattering spectroscopy has been used to observe and characterise hydrogen on the carbon component of a Pt/C catalyst. INS provides the complete vibration spectrum of coronene, regarded as a molecular model of a graphite layer. The vibrational modes are assigned with the aid of ab initio density functional theory calculations and the INS spectra by the a-CLIMAX program. A spectrum for which the H modes of coronene have been computationally suppressed, a carbon-only coronene spectrum, is a better representation of the spectrum of a graphite layer than is coronene itself. Dihydrogen dosing of a Pt/C catalyst caused amplification of the surface modes of carbon, an effect described as H riding on carbon. From the enhancement of the low energy carbon modes (100-600 cm(-1)) it is concluded that spillover hydrogen becomes attached to dangling bonds at the edges of graphitic regions of the carbon support. (C) 2003 Elsevier Science B.V. All rights reserved.

Structure, rheology and shear alignment of Pluronic block copolymer mixtures

The structure and flow behaviour of binary mixtures of Pluronic block copolymers P85 and P123 is investigated by small-angle scattering, rheometry and mobility tests. Micelle dimensions are probed by dynamic light scattering. The micelle hydrodynamic radius for the 50/50 mixture is larger than that for either P85 or P123 alone, Clue to the formation of mixed micelles with a higher association number. The phase diagram for 50/50 mixtures contains regions Of Cubic and hexagonal phases similar to those for the parent homopolymers, however the region of stability of the cubic phase is enhanced at low temperature and concentrations above 40 wt%. This is ascribed to favourable packing of the mixed micelles containing core blocks with two different chain lengths, but similar corona chain lengths. The shear flow alignment of face-centred cubic and hexagonal phases is probed by in situ small-angle X-ray or neutron scattering with simultaneous rheology. The hexagonal phase can be aligned using steady shear in a Couette geometry, however the high modulus Cubic phase cannot be aligned well in this way. This requires the application of oscillatory shear or compression. (C) 2008 Elsevier Inc. All rights reserved.

Dihydrogen in zeolite CaX: an inelastic neutron scattering study

We report an inelastic neutron scattering (INS) study of the rotational–vibrational spectrum of dihydrogen sorbed by zeolite CaX. In the low energy (<200 cm−1) INS spectrum of adsorbed H2 we observe the rotational–vibrational spectrum of H2, where the vibration is that of the H2 molecule against the binding site (i.e. H2–X, not H–H). We have observed for the first time the vibrational overtones of the hydrogen molecule against the adsorption surface up to sixth order. These vibrations are usually forbidden in INS spectroscopy because of the selection rules imposed by the spin flip event required. In our case we are able to observe such a vibration because the rotational transition J(1 ← 0) convolutes the vibrational spectrum. This paper reports the effect for the first time.

A study by high energy transfer inelastic neutron scattering spectroscopy of the mineral fraction of ox femur bone

We have used high energy transfer (HET) inelastic neutron scattering spectroscopy to measure the vibrational modes in the spectra of hydroxyapatite, bone and brushite to confirm our earlier work that only a fraction of the hydroxyl groups in bone mineral are substituted. The HET spectra are better observed due to the higher scattering cross section of hydrogen compared with the other elements in the calcium phosphate compounds. (C) 2003 Elsevier Science B.V. All rights reserved.

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Surface structure of thin asymmetric PS-b-PMMA diblock copolymers investigated by atomic force microscopy

Asymmetric poly(styrene-b-methyl methacrylate) (PS-b-PMMA) diblock copolymers of molecular weight M-n = 29,700g mol(-1) (M-PS = 9300 g mol(-1) M-PMMA = 20,100 g mol(-1), PD = 1.15, chi(PS) = 0.323, chi(PMMA) = 0.677) and M-n = 63,900 g mol(-1) (M-PS = 50,500 g mol(-1), M-PMMA = 13,400 g mol(-1), PD = 1.18, chi(PS) = 0.790, chi(PMMA) = 0.210) were prepared via reversible addition-fragmentation chain transfer (RAFT) polymerization. Atomic force microscopy (AFM) was used to investigate the surface structure of thin films, prepared by spin-coating the diblock copolymers on a silicon substrate. We show that the nanostructure of the diblock copolymer depends on the molecular weight and volume fraction of the diblock copolymers. We observed a perpendicular lamellar structure for the high molar mass sample and a hexagonal-packed cylindrical patterning for the lower molar mass one. Small-angle X-ray scattering investigation of these samples without annealing did not reveal any ordered structure. Annealing of PS-b-PMMA samples at 160 degrees C for 24 h led to a change in surface structure.

Modelling small angle neutron scattering data from electrospun fibres

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.