501 resultados para Microcebus, microsatellites


Relevância:

10.00% 10.00%

Publicador:

Resumo:

We describe the development based on 454 pyrosequencing technology of thirteen microsatellite markers for two closely related species of lamprey: Lampetra fluviatilis and L. planeri. The number of alleles per locus ranged from 2 to 5 in L. fluviatilis and from 2 to 6 in L. planeri. Gene diversity ranged from 0.062 to 0.718 in L. fluviatilis and from 0.322 to 0.677 in L. planeri. These markers will be helpful to study population genetic structure of both species and resolve their taxonomic status as separate species or ecotypes of a single species.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have amplified a (CA)n:(GT)n microsatellite from the TNF promoters of a panel of mouse strains using the polymerase chain reaction. The length of the microsatellites was polymorphic, with eight alleles observed among 15 inbred strains bearing seven distinct H-2 haplotypes, and four outbred strains. In B10 congenic strains, the TNF allele detected by microsatellite polymorphism segregated with the MHC, and in recombinant haplotypes (NOD, NZW), it segregated with H-2D. The TNF allele found in the NZW strain (H-2z) was distinct from those of all other haplotypes, consistent with the hypothesis that this strain may carry a genetic defect in TNF production.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The common shrew Sorex araneus Linnaeus, 1758 is subject to intense chromosomal polymorphism. About 65 chromosome races are presently known. One of these chromosome races (the Valais race) is karyologically, morphologically, biochemically, and genetically clearly distinct from all other chromosome races of the species. Recent studies of hybrid zones between the Valais race and other chromosome races in the Swiss and French Alps add further strong evidence for the specific taxonomic status of the Valais race. Chromosomes and diagnostic protein markers reveal sharp frequency clines and strong heterozygote deficits. In one hybrid zone, the maintenance of the strong genetic differentiation of the hybridizing taxa was confirmed by a study with autosomal microsatellites indicating minimal gene flow. A microsatellite marker on the Y-chromosome showed complete absence of male mediated gene flow suggesting hybrid male sterility. To clarify the taxonomic status of this taxon, additional analyses were conducted. A morphometric analysis of the mandible indicated the Valais race is morphologically as distinct from neighbouring chromosome races of S. araneus as from other related Sorex species. In a phylogeny based on complete mitochondrial DNA cytochrome b gene sequences, the Valais race clearly appears as the sister taxon to all other races of S. araneus. Therefore, the chromosome race Valais of S. araneus herein is elevated to specific status and the name Sorex antinorii Bonaparte, 1840 is applied.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

It is important to characterise the amount of variation on the mammalian Y chromosome in order to assess its potential for use in evolutionary studies. We report very low levels of polymorphism on the Y chromosome of Saudi-Arabian hamadryas baboons, Papio hamadryas hamadryas. We found no segregating sites on the Y, despite sequence analysis of 3 kb noncontiguous intron sequence in 16 males with divergent autosomal microsatellite genotypes, and a further analysis of 1.1 kb intron sequence in 97 males from four populations by SSCP. In addition, we tested seven human-derived Y-linked microsatellites in baboons. Only four of these loci were male-specific and only one was polymorphic in our 97 male sample set. Polymorphism on the Y chromosome of Arabian hamadryas appears to be low compared to other primate species for which data are available (eg humans, chimpanzees and bonobos). Low effective population size (Ne) of paternal genes due to polygyny and female-biased adult sex ratio is a potential reason for low Y chromosome variation in this species. However, low Ne for the Y should be counterbalanced to some extent by the species' atypical pattern of male philopatry and female-biased dispersal. Allelic richness averaged over seven loci was not significantly different between an African and an Arabian population, suggesting that loss of variation during the colonisation of Arabia does not explain low Y variation. Finally, in the absence of nucleotide polymorphism, it is unclear to what extent selection could be responsible for low Y variation in this species.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

BACKGROUND: The estimation of demographic parameters from genetic data often requires the computation of likelihoods. However, the likelihood function is computationally intractable for many realistic evolutionary models, and the use of Bayesian inference has therefore been limited to very simple models. The situation changed recently with the advent of Approximate Bayesian Computation (ABC) algorithms allowing one to obtain parameter posterior distributions based on simulations not requiring likelihood computations. RESULTS: Here we present ABCtoolbox, a series of open source programs to perform Approximate Bayesian Computations (ABC). It implements various ABC algorithms including rejection sampling, MCMC without likelihood, a Particle-based sampler and ABC-GLM. ABCtoolbox is bundled with, but not limited to, a program that allows parameter inference in a population genetics context and the simultaneous use of different types of markers with different ploidy levels. In addition, ABCtoolbox can also interact with most simulation and summary statistics computation programs. The usability of the ABCtoolbox is demonstrated by inferring the evolutionary history of two evolutionary lineages of Microtus arvalis. Using nuclear microsatellites and mitochondrial sequence data in the same estimation procedure enabled us to infer sex-specific population sizes and migration rates and to find that males show smaller population sizes but much higher levels of migration than females. CONCLUSION: ABCtoolbox allows a user to perform all the necessary steps of a full ABC analysis, from parameter sampling from prior distributions, data simulations, computation of summary statistics, estimation of posterior distributions, model choice, validation of the estimation procedure, and visualization of the results.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to characterize mandarin (Citrus spp.) germplasm from Southern Brazil by morphological and molecular analyses. Thirty seven cultivars from 34 distinct mandarin varieties were evaluated by morphological and agronomic traits of leaves, flowers and fruits, and by microsatellite markers. The morphological and agronomic characteristics suggested that almost all varieties can be produced for commercial use, and some, as the Satsuma variety, are recommended for breeding programs. Pooled DNA samples from 1-5 plants belonging to each cultivar were tested. Eight of the nine primers detected polymorphisms. Specific markers were found for some accessions. The dendrogram constructed with the morphological results divided the 37 cultivars into four groups, while that obtained with the microsatellites clustered 35 of the 37 cultivars into three groups only. Generally, intervarietal differences are not high, and this lack of agreement in the two multifactorial analyses indicates that diverse evolutionary factors are acting at these two levels of investigation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We investigate the variation in quantitative and molecular traits in the freshwater snail Galba truncatula, from permanent and temporary water habitats. Using a common garden experiment, we measured 20 quantitative traits and molecular variation using seven microsatellites in 17 populations belonging to these two habitats. We estimated trait means in each habitat. We also estimated the distributions of overall genetic quantitative variation (QST), and of molecular variation (FST), within and between habitats. Overall, we observed a lack of association between molecular and quantitative variance. Among habitats, we found QST>FST, an indication of selection for different optima. Individuals from temporary water habitat matured older, at a larger size and were less fecund than individuals from permanent water habitat. We discuss these findings in the light of several theories for life-history traits evolution.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to identify expressed simple sequence repeats (SSR) markers associated to leaf miner resistance in coffee progenies. Identification of SSR markers was accomplished by directed searches on the Brazilian Coffee Expressed Sequence Tags (EST) database. Sequence analysis of 32 selected SSR loci showed that 65% repeats are of tetra-, 21% of tri- and 14% of dinucleotides. Also, expressed SSR are localized frequently in the 5'-UTR of gene transcript. Moreover, most of the genes containing SSR are associated with defense mechanisms. Polymorphisms were analyzed in progenies segregating for resistance to the leaf miner and corresponding to advanced generations of a Coffea arabica x Coffea racemosa hybrid. Frequency of SSR alleles was 2.1 per locus. However, no polymorphism associated with leaf miner resistance was identified. These results suggest that marker-assisted selection in coffee breeding should be performed on the initial cross, in which genetic variability is still significant.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to validate microsatellite markers associated with resistance to soybean cyst nematode (Heterodera glycines Ichinohe) races 3 and 14, in soybean (Glycine max L.) genotypes, for use in marker-assisted selection (MAS) programs. Microsatellites of soybean linkage groups A2, D2 and G were tested in two populations, and their selection efficiencies were determined. The populations were 65 F2:3 families from Msoy8001 (resistant) x Conquista (susceptible) cross, and 66 F2:3 families of S5995 (resistant) x Renascença (susceptible) cross, evaluated for resistance to races 3 and 14, respectively. Families with female index up to 30% were considered moderately resistant. Markers of A2 and G linkage groups were associated with resistance to race 3. Markers Satt309 and GMENOD2B explained the greatest proportion of phenotypic variance in the different groups. The combinations Satt309+GMENOD2B and Satt309+Satt187 presented 100% selection efficiency. Resistance to race 14 was associated with markers of G linkage group, and selection efficiency in the Satt309+Satt356 combination was 100%. The selection differential obtained by phenotypic and marker assisted selection showed that both can result in similar gains.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to evaluate the genetic diversity of Brazilian Pantaneiro horse by microsatellite markers, investigate the effect of genetic bottlenecks and estimate genetic differentiation among four horse breeds. Genetic variation was estimated through allele frequencies and mean breed heterozygosity. Nei's genetic distances among the breeds Pantaneiro, Thoroughbred, Arabian, Spanish Pure Breed (Andalusian), and Uruguay Creole were calculated, and it was used to construct an UPGMA dendrogram. Clustering at different K values was calculated to infer population structure and assign individuals to populations. Nei's distances showed a minimum distance between Pantaneiro horse and Spanish Pure Breed (0.228), and similar distances from Spanish Pure Breed to Thoroughbred and to Arabian (0.355 and 0.332). It was observed a great level of diversity, clear distance from Pantaneiro horse to other breeds, and genetic uniformity within breed. It was verified a certain level of substructure of Pantaneiro horse showing no influences from the other studied breeds.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Abstract The giant hogweed (Heracleum mantegazzianum) has successfully invaded 19 European countries as well as parts of North America. It has become a problematic species due to its ability to displace native flora and to cause public health hazards. Applying population genetics to species invasion can help reconstruct invasion history and may promote more efficient management practice. We thus analysed levels of genetic variation and population genetic structure of H. mantegazzianum in an invaded area of the western Swiss Alps as well as in its native range (the Caucasus), using eight nuclear microsatellite loci together with plastid DNA markers and sequences. On both nuclear and plastid genomes, native populations exhibited significantly higher levels of genetic diversity compared to invasive populations, confirming an important founder event during the invasion process. Invasive populations were also significantly more differentiated than native populations. Bayesian clustering analysis identified five clusters in the native range that corresponded to geographically and ecologically separated groups. In the invaded range, 10 clusters occurred. Unlike native populations, invasive clusters were characterized by a mosaic pattern in the landscape, possibly caused by anthropogenic dispersal of the species via roads and direct collection for ornamental purposes. Lastly, our analyses revealed four main divergent groups in the western Swiss Alps, likely as a consequence of multiple independent establishments of H. mantegazzianum.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this study was to evaluate the genetic variability of rice (Oryza sativa) landraces collected in Brazilian small farms. Twelve simple sequence repeat (SSR) markers characterized 417 landraces collected in 1986, 1987 and 2003, in the state of Goiás, Brazil. The number of landraces with long and thin grain type increased in the evaluated period, probably due to market demand. Based on the molecular data, the genetic variability increased during this period and, as per to the factorial correspondence analysis, most of the accessions were grouped according to the year of collection. The incorporation of modern rice cultivars in landrace cultivation areas and the selection carried out by small farmers are the most probable factors responsible for increasing landrace genetic variability, during the evaluated period. Genotype exchange between farmers, selection practice and local environmental adaptation are able to generate novel adapted allele combinations, which can be used by breeding programs, to reinitiate the process.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to evaluate a set of microsatellite markers for varietal identification and characterization of the most widespread potato cultivars in Brazil. The DNA from 14 potato cultivars was genotyped using microsatellite markers and the alleles were scored in silver-stained polyacrylamide gel. Twenty-four microsatellite markers were evaluated, and only one locus was monomorphic. Based on band patterns, a set of two microsatellites that were able to identify and differentiate all examined cultivars was obtained.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to develop new irrigated rice lines tolerant to imidazolinone herbicides. The backcross breeding procedure was used to transfer the imidazolinone tolerance allele from mutant 93AS3510 to the recurrent parents 'BRS 7 Taim' and 'BRS Pelota'. Individual herbicide-tolerant plants were selected in each generation, for three backcrossings (RC1 to RC3), followed by three selfing generations (RC3F1 to RC3F3). The best four RC3F3 lines for agronomic traits were genotyped with 44 microsatellite markers. The observed conversion index of the new imidazolinone-tolerant lines varied from 91.86 to 97.67%. Pairwise genetic distance analysis between these lines and 22 accessions from the Embrapa's Rice Germplasm Bank clustered the new lines with their respective recurrent parents, but not with 'IRGA 417', which was originally used as recurrent parent to derive IRGA 422 CL, the only imidazolinone-tolerant irrigated rice cultivar recommended for cultivation in Brazil. Therefore, these lines represent new options of genetically diverse imidazolinone-tolerant rice accessions. Lines CNA10756 ('BRS Sinuelo CL') and CNA10757 will be released for cultivation in the Clearfield irrigated rice production system in Rio Grande do Sul, Brazil.