898 resultados para Cysteine-rich Repeat


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Glutamate cysteine ligase (GCL) catalyzes the rate-limiting step in the de novo synthesis of glutathione (GSH). The catalytic subunit (GCLC) of GCL contains a GAG trinucleotide-repeat (TNR) polymorphism within the 5'-untranslated region (5'-UTR) that has been associated with various human disorders. Although several studies suggest that this variation influences GSH content, its implication for GCLC expression remains unknown. To better characterize its functional significance, we performed reporter gene assays with constructs containing the complete GCLC 5'-UTR upstream of a luciferase gene. Transfection of these vectors into various human cell lines did not reveal any significant differences between 7, 8, 9, or 10 GAG repeats, under either basal or oxidative stress conditions. To correlate these results with the previously described down-regulation induced by the C-129T GCLC promoter polymorphism, combinations of both variations were tested. Interestingly, the -129T allele down-regulates gene expression when combined with 7 GAG but not with 8, 9, or 10 GAG TNRs. This observation was confirmed in primary fibroblast cells, in which the combination of GAG TNR 7/7 and -129C/T genotypes decreased the GCLC protein level. These results provide evidence that interaction of the two variations can efficiently impair GCLC expression and thus suggest its involvement in the pathogenesis of diseases related to GSH metabolism.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Aegilops biuncialis y Aegilops geniculata son dos especies silvestres alotetraploides, con genomios UM, que constituyen un importante reservorio de genes de interés para la mejora del trigo. En este estudio se ha analizado la distribución cromosómica de diferentes secuencias de tipo microsatélites (?single sequence repeat?, SSR) y su relación con las translocaciones intergenómicas U/M, frecuentes en accesiones de ambas especies. En la mayoría de los cromosomas U y en algunos M, se ha localizado una única señal pericéntromérica de la secuencia (ACG)n, mientras que la secuencia (GAA)n aparece como grandes ?clusters? de localización pericentromérica y, en ocasiones, intersticial. En las 5 accesiones portadoras de translocaciones U/M analizadas, se ha comprobado una asociación estadísticamente significativa entre el punto de rotura-reunión de la reordenación y regiones cromosómicas ricas en secuencias SSR.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The differentiation of neurons and the outgrowth of neurites depends on microtubule-associated proteins such as tau protein. To study this process, we have used the model of Sf9 cells, which allows efficient transfection with microtubule-associated proteins (via baculovirus vectors) and observation of the resulting neurite-like extensions. We compared the phosphorylation of tau23 (the embryonic form of human tau) with mutants in which critical phosphorylation sites were deleted by mutating Ser or Thr residues into Ala. One can broadly distinguish two types of sites, the KXGS motifs in the repeats (which regulate the affinity of tau to microtubules) and the SP or TP motifs in the domains flanking the repeats (which contain epitopes for antibodies diagnostic of Alzheimer’s disease). Here we report that both types of sites can be phosphorylated by endogenous kinases of Sf9 cells, and that the phosphorylation pattern of the transfected tau is very similar to that of neurons, showing that Sf9 cells can be regarded as an approximate model for the neuronal balance between kinases and phosphatases. We show that mutations in the repeat domain and in the flanking domains have opposite effects. Mutations of KXGS motifs in the repeats (Ser262, 324, and 356) strongly inhibit the outgrowth of cell extensions induced by tau, even though this type of phosphorylation accounts for only a minor fraction of the total phosphate. This argues that the temporary detachment of tau from microtubules (by phosphorylation at KXGS motifs) is a necessary condition for establishing cell polarity at a critical point in space or time. Conversely, the phosphorylation at SP or TP motifs represents the majority of phosphate (>80%); mutations in these motifs cause an increase in cell extensions, indicating that this type of phosphorylation retards the differentiation of the cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

One of the hallmarks of Alzheimer disease is the pathological aggregation of tau protein into paired helical filaments (PHFs) and neurofibrillary tangles. Here we describe the in vitro assembly of recombinant tau protein and constructs derived from it into PHFs. Though whole tau assembled poorly, constructs containing three internal repeats (corresponding to the fetal tau isoform) formed PHFs reproducibly. This ability depended on intermolecular disulfide bridges formed by the single Cys-322. Blocking the SH group, mutating Cys for Ala, or keeping tau in a reducing environment all inhibited assembly. With constructs derived from four-repeat tau (having the additional repeat no. 2 and a second Cys-291), PHF assembly was blocked because Cys-291 and Cys-322 interact within the molecule. PHF assembly was enabled again by mutating Cys-291 for Ala. The synthetic PHFs bound the dye thioflavin S used in Alzheimer disease diagnostics. The data imply that the redox potential in the neuron is crucial for PHF assembly, independently or in addition to pathological phosphorylation reactions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A newly described non-long terminal repeat (non-LTR) retrotransposon element was isolated from the genome of the Oriental schistosome, Schistosoma japonicum. At least 1000 partial copies of the element, which was named pido, were dispersed throughout the genome of S. japonicum. As is usual with non-LTR retrotransposons, it is expected that many pido elements will be 5'-truncated. A consensus sequence of 3564 bp of the truncated pido element was assembled from several genomic fragments that contained pido-hybridizing sequences. The sequence encoded part of the first open reading frame (ORF), the entire second ORF and, at its 3'-terminus, a tandemly repetitive, A-rich (TA(6)TA(5)TA(8)) tail, The ORF1 of pido encoded a nucleic acid binding protein and ORF2 encoded a retroviral-like polyprotein that included apurinic/apyrimidinic endonuclease (EN) and reverse transcriptase (RT) domains, in that order. Based on its sequence and structure, and phylogenetic analyses of both the RT and EN domains, pido belongs to the chicken repeat 1 (CR1)-like lineage of elements known from the chicken, turtle, puffer fish, mosquitoes and other taxa. pido shared equal similarity with CRI from chicken, an uncharacterized retrotransposon from Caenorhabditis elegans and SR1 (a non-LTR retrotransposon) from the related blood fluke Schistosoma mansoni; the level of similarity between pido and SR1 indicated that these two schistosome retrotransposons were related but not orthologous. The findings indicate that schistosomes have been colonized by at least two discrete CRI-like elements. Whereas pido did not appear to have a tight target site specificity, at least one copy of pido has inserted into the 3'-untranslated region of a protein-encoding gene (GeriBank AW736757) of as yet unknown identity. mRNA encoding the RT of pido was detected by reverse transcription-polymerase chain reaction in the egg, miracidium. and adult developmental stages of S. japonicum, indicating that the RT domain was transcribed and suggesting that pido was replicating actively and mobile within the S. japonicum genome. (C) 2002 Elsevier Science B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Millions of people suffer from superficial infections caused by dermatophytes. Intriguingly, these filamentous fungi exclusively infect keratin-rich host structures such as hair, nails, and skin. Keratin is a hard, compact protein, and its utilization by dermatophytes for growth has long been discussed as a major virulence attribute. Here, we provide strong support for the hypothesis that keratin degradation is facilitated by the secretion of the reducing agent sulfite, which can cleave keratin-stabilizing cystine bonds. We discovered that sulfite is produced by dermatophytes from environmental cysteine, which at elevated concentrations is toxic for microbes and humans. We found that sulfite formation from cysteine relies on the key enzyme cysteine dioxygenase Cdo1. Sulfite secretion is supported by the sulfite efflux pump Ssu1. Targeted mutagenesis proved that dermatophyte mutants in either Cdo1 or Ssu1 were highly growth-sensitive to cysteine, and mutants in Ssu1 were specifically sensitive to sulfite. Most notably, dermatophyte mutants in Cdo1 and Ssu1 were specifically growth-defective on hair and nails. As keratin is rich in cysteine, our identified mechanism of cysteine conversion and sulfite efflux supports both cysteine and sulfite tolerance per se and progression of keratin degradation. These in vitro findings have implications for dermatophyte infection pathogenesis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In this work we investigated the frequency of polymorphism in exon II of the gene encoding most of the amino-terminal region of the serine rich antigen (SERA) in Plasmodium falciparum field samples. The blood samples were colleted from P. falciparum infected individuals in three areas of the Brazilian Amazon. Two fragments have been characterized by polymerase chain reaction: one of 175 bp corresponding to the repeat region with 5 octamer units and one other of 199 bp related to the 6 repeat octamer units of SERA protein. The 199 bp fragment was the predominant one in all the studied areas. The higher frequency of this fragment has not been described before and could be explained by an immunological selection of the plasmodial population in the infected individuals under study. Since repeat motifs in the amino-terminal region of SERA contain epitopes recognized by parasite-inhibitor antibodies, data reported here suggest that the analysis of the polymorphism of P. falciparum isolates in different geographical areas is a preliminary stage before the final drawing of an universal vaccine against malaria can be reached.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A spontaneous high hydrostatic pressure (HHP)-tolerant mutant of Listeria monocytogenes ScottA, named AK01, was isolated previously. This mutant was immotile and showed increased resistance to heat, acid and H2O2 compared with the wild type (wt) (Karatzas, K.A.G. and Bennik, M.H.J. 2002 Appl Environ Microbiol 68: 3183–3189). In this study, we conclusively linked the increased HHP and stress tolerance of strain AK01 to a single codon deletion in ctsR (class three stress gene repressor) in a region encoding a highly conserved glycine repeat. CtsR negatively regulates the expression of the clp genes, including clpP, clpE and the clpC operon (encompassing ctsR itself), which belong to the class III heat shock genes. Allelic replacement of the ctsR gene in the wt background with the mutant ctsR gene, designated ctsRΔGly, rendered mutants with phenotypes and protein expression profiles identical to those of strain AK01. The expression levels of CtsR, ClpC and ClpP proteins were significantly higher in ctsRΔGly mutants than in the wt strain, indicative of the CtsRΔGly protein being inactive. Further evidence that the CtsRΔGly protein lacks its repressor function came from the finding that the Clp proteins in the mutant were not further induced upon heat shock, and that HHP tolerance of a ctsR deletion strain was as high as that of a ctsRΔGly mutant. The high HHP tolerance possibly results from the increased expression of the clp genes in the absence of (active) CtsR repressor. Importantly, the strains expressing CtsRΔGly show significantly attenuated virulence compared with the wt strain; however, no indication of disregulation of PrfA in the mutant strains was found. Our data highlight an important regulatory role of the glycine-rich region of CtsR in stress resistance and virulence.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The present study aims to investigate the dose dependent effects of consuming diets enriched in flavonoid-rich and flavonoid-poor fruits and vegetables on the urine metabolome of adults who had a C1.5 fold increased risk of cardiovascular diseases. A single-blind, dose-dependent, parallel randomized controlled dietary intervention was conducted where volunteers (n = 126) were randomly assigned to one of three diets: high flavonoid diet, low flavonoid diet or habitual diet as a control for 18 weeks. High resolution LC– MS untargeted metabolomics with minimal sample cleanup was performed using an Orbitrap mass spectrometer. Putative biomarkers which characterize diets with high and low flavonoid content were selected by state-of-the-art data analysis strategies and identified by HR-MS and HR-MS/MS assays. Discrimination between diets was observed by application of two linear mixedmodels: one including a diet-time interaction effect and the second containing only a time effect. Valerolactones, phenolic acids and their derivatives were among sixteen biomarkers related to the high flavonoid dietary exposure. Four biomarkers related to the low flavonoid diet belonged to the family of phenolic acids. For the first time abscisic acid glucuronide was reported as a biomarker after a dietary intake, however its origins have to be examined by future hypothesis driven experiments using a more targeted approach. This metabolomic analysis has identified a number of dose dependent urinary biomarkers (i.e. proline betaine or iberin-N-acetyl cysteine), which can be used in future observation and intervention studies to assess flavonoids and nonflavonoid phenolic intakes and compliance to fruit and vegetable intervention.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Kaposi's sarcoma-associated herpesvirus (KSHV/human herpesvirus 8 [HHV8]) and Epstein-Barr virus (EBV/HHV4) are distantly related gammaherpesviruses causing tumors in humans. KSHV latency-associated nuclear antigen 1 (LANA1) is functionally similar to the EBV nuclear antigen-1 (EBNA1) protein expressed during viral latency, although they have no amino acid similarities. EBNA1 escapes cytotoxic lymphocyte (CTL) antigen processing by inhibiting its own proteosomal degradation and retarding its own synthesis to reduce defective ribosomal product processing. We show here that the LANA1 QED-rich central repeat (CR) region, particularly the CR2CR3 subdomain, also retards LANA1 synthesis and markedly enhances LANA1 stability in vitro and in vivo. LANA1 isoforms have half-lives greater than 24 h, and fusion of the LANA1 CR2CR3 domain to a destabilized heterologous protein markedly decreases protein turnover. Unlike EBNA1, the LANA1 CR2CR3 subdomain retards translation regardless of whether it is fused to the 5′ or 3′ end of a heterologous gene construct. Manipulation of sequence order, orientation, and composition of the CR2 and CR3 subdomains suggests that specific peptide sequences rather than RNA structures are responsible for synthesis retardation. Although mechanistic differences exist between LANA1 and EBNA1, the primary structures of both proteins have evolved to minimize provoking CTL immune responses. Simple strategies to eliminate these viral inhibitory regions may markedly improve vaccine effectiveness by maximizing CTL responses. Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Short tandem DNA repeats and telomerase compose the telomere structure in the vast majority of eukaryotic organisms. However, such a conserved organisation has not been found in dipterans. While telomeric DNA in Drosophila is composed of specific retrotransposons, complex terminal tandem repeats are present in chromosomes of Anopheles and chironomid species. In the sciarid Rhynchosciara americana, short repeats (16 and 22 bp long) tandemly arrayed seem to reach chromosome ends. Moreover, in situ hybridisation data using homopolymeric RNA probes suggested in this species the existence of a third putative chromosome end repeat enriched with (dA).(dT) homopolymers. In this work, chromosome micro-dissection and PCR primed by homopolymeric primers were employed to clone these repeats. Named T-14 and 93 % AT-rich, the repetitive unit is 14 bp long and appears organised in tandem arrays. It is localised in five non-centromeric ends and in four interstitial bands of R. americana chromosomes. To date, T-14 is the shortest repeat that has been characterised in chromosome ends of dipterans. As observed for short tandem repeats identified previously in chromosome ends of R. americana, the T-14 probe hybridised to bridges connecting non-homologous polytene chromosome ends, indicative of close association of T-14 repeats with the very end of the chromosomes. The results of this work suggest that R. americana represents an additional example of organism provided with more than one DNA sequence that is able to reach chromosome termini.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Plasmodium cysteine proteases are essential for host-cell invasion and egress, hemoglobin degradation, and intracellular development of the parasite. The temporal, site-specific regulation of cysteine-protease activity is a prerequisite for survival and propagation of Plasmodium. Recently, a new family of inhibitors of cysteine proteases (ICPs) with homologs in at least eight Plasmodium species has been identified. Here, we report the 2.6 A X-ray crystal structure of the C-terminal, inhibitory domain of ICP from P. berghei (PbICP-C) in a 1:1 complex with falcipain-2, an important hemoglobinase of Plasmodium. The structure establishes Plasmodium ICP as a member of the I42 class of chagasin-like protease inhibitors but with large insertions and differences in the binding mode relative to other family members. Furthermore, the PbICP-C structure explains why host-cell cathepsin B-like proteases and, most likely, also the protease-like domain of Plasmodium SERA5 (serine-repeat antigen 5) are no targets for ICP.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Click chemistry is a powerful technology for the functionalization of therapeutic proteins with effector moieties, because of its potential for bio-orthogonal, regio-selective, and high-yielding conjugation under mild conditions. Designed Ankyrin Repeat Proteins (DARPins), a novel class of highly stable binding proteins, are particularly well suited for the introduction of clickable methionine surrogates such as azidohomoalanine (Aha) or homopropargylglycine (Hpg), since the DARPin scaffold can be made methionine-free by an M34L mutation in the N-cap which fully maintains the biophysical properties of the protein. A single N-terminal azidohomoalanine, replacing the initiator Met, is incorporated in high yield, and allows preparation of "clickable" DARPins at about 30 mg per liter E. coli culture, fully retaining stability, specificity, and affinity. For a second modification, we introduced a cysteine at the C-terminus. Such DARPins could be conveniently site-specifically linked to two moieties, polyethylene glycol (PEG) to the N-terminus and the fluorophore Alexa488 to the C-terminus. We present a DARPin selected against the epithelial cell adhesion molecule (EpCAM) with excellent properties for tumor targeting as an example. We used these doubly modified molecules to measure binding kinetics on tumor cells and found that PEGylation has no effect on dissociation rate, but slightly decreases the association rate and the maximal number of cell-bound DARPins, fully consistent with our previous model of PEG action obtained in vitro. Our data demonstrate the benefit of click chemistry for site-specific modification of binding proteins like DARPins to conveniently add several functional moieties simultaneously for various biomedical applications.