A rotating disc voltammetry study of the 1,8-dihydroxyanthraquinone mediated reduction of colloidal indigo

Colloidal indigo is reduced to an aqueous solution of leuco-indigo in a mediated two-electron process converting the water-insoluble dye into the water-soluble leuco form. The colloidal dye does not interact directly with the electrode surface, and to employ an electrochemical process for this reduction, the redox mediator 1,8-dihydroxyanthraquinone (1,8-DHAQ) is used to transfer electrons from the electrode to the dye. The mediated reduction process is investigated at a (500-kHz ultrasound-assisted) rotating disc electrode, and the quantitative analysis of voltammetric data is attempted employing the Digisim numerical simulation software package. At the most effective temperature, 353 K, the diffusion coefficient for 1,8-DHAQ is (0.84 +/- 0.08)x10(-9) m(2) s(-1), and it is shown that an apparently kinetically controlled reaction between the reduced form of the mediator and the colloidal indigo occurs within the diffusion layer at the electrode surface. The apparent bimolecular rate constant k (app)=3 mol m(-3) s(-1) for the rate law d[leuco-indigo]/dt = k(app) x [mediator] x [indigo] is determined and attributed to a mediator diffusion controlled dissolution of the colloid particles. The average particle size and the number of molecules per particles are estimated from the apparent bimolecular rate constant and confirmed by scanning electron microscopy.

The photodimerisation of the alpha- and beta-forms of trans-cinnamic acid: a study of single crystals by vibrational microspectroscopy

Infrared and Raman microspectroscopy have been used to follow the photodimerisation reactions of single crystals, the alpha- and beta-forms of trans-cinnamic acid. This approach allows the starting materials and products -alpha-truxillic acid that has C-i symmetry and beta-truxinic acid, which has C-s symmetry-to be identified. It also allows the topotactic nature of the reaction to be confirmed. Attempts to produce the poorly-defined unreactive gamma-form of trans-cinnamic acid resulted only in a mixture of the alpha- and beta-forms. The findings suggest a wide role for these spectroscopic methods in monitoring solid-state organic reactions. (C) 2002 Elsevier Science B.V. All rights reserved.

Stepwise self-assembly of a tripeptide from molecular dimers to supramolecular beta-sheets in crystals and amyloid-like fibrils in the solid state

The terminally protected tripeptide Boc-Ala(1)-Leu(2)-Ala(3)-OMe 1 forms antiparallel hydrogen-bonded dimers of two different conformers in the asymmetric unit and the individual dimers then self-associate to form supramolecular beta-sheet structures in crystals and amyloid-like fibrils in the solid state.

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Colloidal stable silica encapsulated nano-magnetic composite as a novel bio-catalyst carrier

A colloidal stable silica-encapsulated magnetic nano-composite of a controlled dimension is, for the first time, employed to carry beta-lactamase via chemical linkage on the silica overlayer: activity study reflects that this new type of immobilisation allows site (enzyme) isolation, accessibility as good as free enzyme and recovery & reusability upon application of magnetic separation.

Gas-solid reactions of single crystals: a study of reactions of NH3 and NO2 with single crystalline organic substrates by infrared microspectroscopy

Reaction of single crystals of benzoic and trans-cinnamic acids with 200 Torr pressure of ammonia gas in a sealed glass bulb at 20 degrees C generates the corresponding ammonium salts; there is no sign of any 1:2 adduct as has been reported previously for related systems. Isotopic substitution using ND3 has been used to aid identification of the products. Adipic acid likewise reacts with NH3 gas to form a product in which ammonium salts are formed at both carboxylic acid groups. Reaction of 0.5 Torr pressure of NO2 gas with single crystals of 9-methylanthracene and 9-anthracenemethanol in a flow system generates nitrated products where the nitro group appears to be attached at the 10-position, i.e. the position trans to the methyl or methoxy substituent on the central ring. Isotopic substitution using (NO2)-N-15 has been used to confirm the identity of the bands arising from the coordinated NO2 group. The products formed when single crystals of hydantoin are reacted with NO2 gas under similar conditions depend on the temperature of the reaction. At 20 degrees C, a nitrated product is formed, but at 65 degrees C this gives way to a product containing no nitro groups. The findings show the general applicability of infrared microspectroscopy to a study of gas-solid reactions of organic single crystals. (c) 2005 Elsevier B.V. All rights reserved.

Gas-solid reactions of single crystals: a study of the reaction of bromine with single crystals of trans-cinnamic acid and a range of its derivatives by infrared and Raman microspectroscopy

Single crystals of trans-cinnamic acid and of a range of derivatives of this compound containing halogen substituents on the aromatic ring have been reacted with 165 Torr pressure of bromine vapour in a sealed desiccator at 20 degrees C for 1 week. Infrared and Raman microspectroscopic examination of the crystals shows that bromination of the aliphatic double bond, but not of the aromatic ring, has occurred. It is demonstrated also that the reaction is truly gas-solid in nature. A time-dependent study of these reactions shows that they do not follow a smooth diffusion-controlled pathway. Rather the reactions appear to be inhomogeneous and to occur at defects within the crystal. The reaction products are seen to flake from the surface of the crystal. It is shown, therefore, that these are not single crystal to single crystal transitions, as have been observed previously for the photodimerisation of trans-cinnamic acid and several of its derivatives. It is shown that there are no by-products of the reaction and that finely ground samples react to form the same products as single crystals.

Recovery of gallic acid with colloidal gas aphrons (CGA)

In the present paper the potential application of colloidal gas aphrons (CGA) to the recovery of antioxidants from wine-making waste extracts is investigated. CGA were generated by stirring a buffered solution (400 ml) of a cationic surfactant(cetyltrimethylammonium bromide, CTAB) at 8000 rpm for 10 minutes. Trials were carried out on standard solutions (2 ml) of gallic acid (GA) 200 mg/l with varying volumes of colloidal gas aphrons (20-60 ml) generated with varying concentrations of CTAB (2 and 4 mM). Influence of pH, solvent (buffered aqueous solution and ethanol), CTAB to GA molar ratio on recovery were studied. Best recovery (63%) was achieved from an aqueous solution of GA and at a CTAB to GA molar ratio of 16. Separation is mainly driven by electrostatic interactions but pH conditions are to be optimised to preserve the GA antioxidant power.

Recovery of lactoferrin and lactoperoxidase from sweet whey using colloidal gas aphrons (CGAs) generated from an anionic surfactant, AOT

The recovery of lactoferrin and lactoperoxidase from sweet whey was studied using colloidal gas aphrons (CGAs), which are surfactant-stabilized microbubbles (10-100 mum). CGAs are generated by intense stirring (8000 rpm for 10 min) of the anionic surfactant AOT (sodium bis-2-ethylhexyl sulfosuccinate). A volume of CGAs (10-30 mL) is mixed with a given volume of whey (1 - 10 mL), and the mixture is allowed to separate into two phases: the aphron (top) phase and the liquid (bottom) phase. Each of the phases is analyzed by SDS-PAGE and surfactant colorimetric assay. A statistical experimental design has been developed to assess the effect of different process parameters including pH, ionic strength, the concentration of surfactant in the CGAs generating solution, the volume of CGAs and the volume of whey on separation efficiency. As expected pH, ionic strength and the volume of whey (i.e. the amount of total protein in the starting material) are the main factors influencing the partitioning of the Lf(.)Lp fraction into the aphron phase. Moreover, it has been demonstrated that best separation performance was achieved at pH = 4 and ionic strength = 0.1 mol/L i.e., with conditions favoring electrostatic interactions between target proteins and CGAs (recovery was 90% and the concentration of lactoferrin and lactoperoxidase in the aphron phase was 25 times higher than that in the liquid phase), whereas conditions favoring hydrophobic interactions (pH close to pI and high ionic strength) led to lower performance. However, under these conditions, as confirmed by zeta potential measurements, the adsorption of both target proteins and contaminant proteins is favored. Thus, low selectivity is achieved at all of the studied conditions. These results confirm the initial hypothesis that CGAs act as ion exchangers and that the selectivity of the process can be manipulated by changing main operating parameters such as type of surfactant, pH and ionic strength.

An insight into the mechanism of protein separation by colloidal gas aphrons (CGA) generated from ionic surfactants

Colloidal gas aphrons (CGA), which are surfactant stabilised microbubbles, have been previously applied for the recovery of proteins from model mixtures and a few studies have demonstrated the potential of these dispersions for the selective recovery of proteins from complex mixtures. However there is a lack of understanding of the mechanism of separation and forces governing the selectivity of the separation. In this paper a mechanistic study is carried out to determine the main factors and forces influencing the selectivity of separation of whey proteins with CGA generated from ionic surfactants. Two different separation strategies were followed: (i) separation of lactoferrin and lactoperoxidase by anionic CGA generated from a solution of sodium bis-(2-ethyl hexyl) sulfosuccinate (AOT); (ii) separation of beta-lactoglobulin by cationic CGA generated from a solution of cetyltrimethylammonium bromide (CTAB). Separation results indicate that electrostatic interactions are the main forces determining the selectivity however these could not completely explain the selectivities obtained following both strategies. Protein-surfactant interactions were studied by measuring the zeta potential changes on individual proteins upon addition of surfactant and at varying pH. Interestingly strongest electrostatic interactions were measured at those pH and surfactant to protein mass ratios which were optimum for protein separation. Effect of surfactant on protein conformation was determined by measuring the change in fluorescence intensity upon addition of surfactant at varying pH. Differences in the fluorescence patterns were detected among proteins which were correlated to differences in their conformational features which could in turn explain their different separation behaviour. The effect of conformation on selectivity was further proven by experiments in which conformational changes were induced by pre-treatment of whey (heating) and by storage at 4 degrees C. Overall it can be concluded that separation of proteins by ionic CGA is driven mainly by electrostatic interactions however conformational features will finally determine the selectivity of the separation with competitive adsorption having also an effect. (c) 2006 Elsevier B.V. All rights reserved.

Recovery of astaxanthin using colloidal gas aphrons (CGA): a mechanistic study

The aim of this study is to investigate the mechanism responsible for the recovery of astaxanthin using Colloidal Gas Aphrons (CGA), which are surfactant stabilised microbubbles. The latter were produced using different surfactant solutions (Cetyl Trimethyl Ammonium Bromide (CTAB)-cationic, Sodium Dodecyl Sulfate (SDS)-anionic, TWEEN 60-non-ionic and mixtures of TWEEN 60-SPAN 80- non-ionic with varying hydrophobicity) at stirring speed 8000 rpm and stirring time 5 min. Experiments were carried out at varying pH and volumetric ratios of astaxanthin to CGA, and with two different astaxanthin standard suspensions: (i) astaxanthin dispersed in aqueous solutions and (ii) astaxanthin dispersed in ethanolic/aqueous solutions with different compositions of ethanol (20/80 (v/v) and 40/60 (v/v)). When astaxanthin is dispersed in aqueous solutions the separation seems to occur mainly by electrostatic interactions. Therefore the recoveries are higher in the case of the cationic surfactant when astaxanthin particles are strongly negatively charged, as shown by the zeta potential measurements. When ethanol is present, highest recoveries are achieved with CGA produced from the non-ionic surfactant, which indicates that, under these conditions, separation is driven mainly by hydrophobic interactions. In experiments with ethanolic/aqueous suspensions, when the hydrophobicity of the surfactant was increased by increasing volumes of SPAN 80, the CGA produced were less stable; thus higher recoveries of astaxanthin under conditions that favour hydrophobic interactions were not observed. (C) 2008 Elsevier B.V All rights reserved.

The use of colloidal gas aphrons as novel downstream processing for the recovery of astaxanthin from cells of Phaffia rhodozyma

BACKGROUND: There is an increasing interest in obtaining natural products with bioactive properties, using fermentation technology. However, the downstream processing consisting of multiple steps can be complicated, leading to increase in the final cost of the product. Therefore there is a need for integrated, cost-effective and scalable separation processes. RESULTS: The present study investigates the use of colloidal gas aphrons (CGA), which are surfactant-stabilized microbubbles, as a novel method for downstream processing. More particularly, their application for the recovery of astaxanthin from the cells of Phaffia rhodozyma is explored. Research carried out with standard solutions of astaxanthin and CGA generated from the cationic surfactant hexadecyl. trimethyl ammonium bromide (CTAB) showed that up to 90% recovery can be achieved under optimum conditions, i.e., pH 11 with NaOH 0.2 mol L-1. In the case of the cells' suspension from the fermentation broth, three different approaches were investigated: (a) the conventional integrated approach where CGA were applied directly; (b) CGA were applied to the clarified suspension of cells; and finally (c) the in situ approach, where CGA are generated within the clarified suspension of cells. Interestingly, in the case of the whole suspension (approach a) highest recoveries (78%) were achieved under the same conditions found to be optimal for the standard solutions. In addition, up to 97% recovery of total carotenoids could be achieved from the clarified suspension after pretreatment with NaOH. This pretreatment led to maximum cell disruption as well as optimum conditioning for subsequent CGA separation. CONCLUSIONS: These results demonstrate the potential of CGA for the recovery of bioactive components from complex feedstock. (c) 2008 Society of Chemical Industry.

Recovery of norbixin from a raw extraction solution of annatto pigments using colloidal gas aphrons (CGAs)

Annatto dyes are widely used in food and are finding increasing interest also for their application in the pharmaceutical and cosmetics industry. Bixin is the main pigment extracted from annatto seeds and accounts for 80% of the carotenoids in the outer coat of the seeds; norbixin being the water-soluble form of the bixin. Typically annatto dyes are extracted from the seeds by mechanical means or solutions of alkali, edible oil or organic solvents, or a combination of the two depending on the desired final product. In this work CGAs are investigated as an alternative separation method for the recovery of norbixin from a raw extraction solution of annatto pigments in KOH. A volume of CGAs generated from a cationic surfactant (CTAB) solution is mixed with a volume of annatto solution and when the mixture is allowed to settle it separates into the top aphron phase and the bottom liquid phase. Potassium norbixinate presented in the annatto solution will interact with the surfactant in the aphron phase, which results in the effective separation of norbixin. Recovery= 94% was achieved at a CTAB to norbixin molar ratio of 3.3. In addition a mechanism of separation is proposed here based on the separation results with the cationic surfactant and an anionic surfactant (bis-2-ethyl hexyl sulfosuccinate, AOT) and measurements of surfactant to norbixin ratio in the aphron phase; electrostatic interactions between the surfactant and norbixin molecules result in the fort-nation of a coloured complex and effective separation of norbixin. (c) 2005 Elsevier B.V. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.