931 resultados para Amplified Spontaneous Emission (ASE)


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tendon rupture has rarely been described in patients with systemic lupus erythematosus. From observation of three cases of Jaccoud`s arthropathy with tendon rupture, and considering that this arthropathy is more related to an inflammatory process of the tendon sheath than to synovitis per se, the intention of this study was to review the cases of tendon rupture in patients with systemic lupus erythematosus, in the hope of determining the frequency of Jaccoud`s arthropathy associated with this complication. Systematic review using MEDLINE, Scielo and LILACS databases (1966 to 2009) and the following keywords: systemic lupus erythematosus, tendon rupture, Jaccoud`s arthropathy. Secondary references were additionally obtained. Additionally, three Brazilian systemic lupus erythematosus patients who developed tendon rupture are described. Only 40 articles obtained fulfilled the previously established criteria. They were all case reports; the number of cases reported was 52 which, together with the three cases presented herein add up to 55 cases. Forty-six patients were women aged between 19 and 71 years, with a mean age of 40.1 +/- 12.4 years, and the average duration of the disease was 10 years. The most frequently observed rupture sites were the patellar and Achilles` tendons. While almost all patients described were on various doses of corticosteroids, 16 patients concomitantly had Jaccoud`s arthropathy (29%). In conclusion, the association between Jaccoud`s arthropathy and tendon rupture in systemic lupus erythematosus has been underestimated. As almost one-third of the systemic lupus erythematosus patients with tendon rupture also have Jaccoud`s arthropathy, this arthropathy may be recognized as risk marker for tendon rupture. Lupus (2010) 19, 247-254.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background-Prasugrel is a novel thienopyridine that reduces new or recurrent myocardial infarctions (MIs) compared with clopidogrel in patients with acute coronary syndrome undergoing percutaneous coronary intervention. This effect must be balanced against an increased bleeding risk. We aimed to characterize the effect of prasugrel with respect to the type, size, and timing of MI using the universal classification of MI. Methods and Results-We studied 13 608 patients with acute coronary syndrome undergoing percutaneous coronary intervention randomized to prasugrel or clopidogrel and treated for 6 to 15 months in the Trial to Assess Improvement in Therapeutic Outcomes by Optimizing Platelet Inhibition With Prasugrel-Thrombolysis in Myocardial Infarction (TRITON-TIMI 38). Each MI underwent supplemental classification as spontaneous, secondary, or sudden cardiac death (types 1, 2, and 3) or procedure related (Types 4 and 5) and examined events occurring early and after 30 days. Prasugrel significantly reduced the overall risk of MI (7.4% versus 9.7%; hazard ratio [HR], 0.76; 95% confidence interval [CI], 0.67 to 0.85; P < 0.0001). This benefit was present for procedure-related MIs (4.9% versus 6.4%; HR, 0.76; 95% CI, 0.66 to 0.88; P = 0.0002) and nonprocedural (type 1, 2, or 3) MIs (2.8% versus 3.7%; HR, 0.72; 95% CI, 0.59 to 0.88; P = 0.0013) and consistently across MI size, including MIs with a biomarker peak >= 5 times the reference limit (HR. 0.74; 95% CI, 0.64 to 0.86; P = 0.0001). In landmark analyses starting at 30 days, patients treated with prasugrel had a lower risk of any MI (2.9% versus 3.7%; HR, 0.77; P = 0.014), including nonprocedural MI (2.3% versus 3.1%; HR, 0.74; 95% CI, 0.60 to 0.92; P = 0.0069). Conclusion-Treatment with prasugrel compared with clopidogrel for up to 15 months in patients with acute coronary syndrome undergoing percutaneous coronary intervention significantly reduces the risk of MIs that are procedure related and spontaneous and those that are small and large, including new MIs occurring during maintenance therapy. (Circulation. 2009; 119: 2758-2764.)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Lineage-survival oncogenes are activated by somatic DNA alterations in cancers arising from the cell lineages in which these genes play a role in normal development(1,2). Here we show that a peak of genomic amplification on chromosome 3q26.33 found in squamous cell carcinomas (SCCs) of the lung and esophagus contains the transcription factor gene SOX2, which is mutated in hereditary human esophageal malformations(3), is necessary for normal esophageal squamous development(4), promotes differentiation and proliferation of basal tracheal cells(5) and cooperates in induction of pluripotent stem cells(6-8). SOX2 expression is required for proliferation and anchorage-independent growth of lung and esophageal cell lines, as shown by RNA interference experiments. Furthermore, ectopic expression of SOX2 here cooperated with FOXE1 or FGFR2 to transform immortalized tracheobronchial epithelial cells. SOX2-driven tumors show expression of markers of both squamous differentiation and pluripotency. These characteristics identify SOX2 as a lineage-survival oncogene in lung and esophageal SCC.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Femoral neck fracture without associated trauma following consolidation of a transtrochanteric fracture is a rare event. The authors report a case of transtrochanteric fracture that was treated with PFN and which presented fracturing of the femoral neck two weeks after removal of the device. This occurrence was treated with partial arthroplasty.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND AND PURPOSE: Functional brain variability has been scarcely investigated in cognitively healthy elderly subjects, and it is currently debated whether previous findings of regional metabolic variability are artifacts associated with brain atrophy. The primary purpose of this study was to test whether there is regional cerebral age-related hypometabolism specifically in later stages of life. MATERIALS AND METHODS: MR imaging and FDG-PET data were acquired from 55 cognitively healthy elderly subjects, and voxel-based linear correlations between age and GM volume or regional cerebral metabolism were conducted by using SPM5 in images with and without correction for PVE. To investigate sex-specific differences in the pattern of brain aging, we repeated the above voxelwise calculations after dividing our sample by sex. RESULTS: Our analysis revealed 2 large clusters of age-related metabolic decrease in the overall sample, 1 in the left orbitofrontal cortex and the other in the right temporolimbic region, encompassing the hippocampus, the parahippocampal gyrus, and the amygdala. The division of our sample by sex revealed significant sex-specific age-related metabolic decrease in the left temporolimbic region of men and in the left dorsolateral frontal cortex of women. When we applied atrophy correction to our PET data, none of the above-mentioned correlations remained significant. CONCLUSIONS: Our findings suggest that age-related functional brain variability in cognitively healthy elderly individuals is largely secondary to the degree of regional brain atrophy, and the findings provide support to the notion that appropriate PVE correction is a key tool in neuroimaging investigations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: Because of the controversial biologic tolerance and management, retained intraorbital metallic foreign body (RIMFb) poses a formidable challenge to surgeons. Besides location of the foreign body, indications for surgical management include neurologic injury, mechanical restriction of the eye movement, and development of local infection or draining fistula. The authors describe an unusual case of spontaneous migration of a RIMFb. Methods: A 26-year-old man had a gunshot injury on the left orbit. The patient was initially managed conservatively because of the posterior position of the bullet fragment. Thereafter, because of the clinical impairments and anterior migration of projectile, surgical treatment was considered. Results: Spontaneous anterior migration has led to mechanical disturbances and inflammatory complications that comprise explicit surgical indications for removal. The patient underwent surgery with complete relief of symptoms. We suppose that extrinsic ocular muscles might play a role in shifting large RIMFb over time, leading to change in the management strategies. Conclusions: Spontaneous migration of RIMFb is a rare clinical situation that can lead to pain, local deformity, as well as changes in the management strategies of the affected patients even in the late phase of follow-up.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose To assess the cost effectiveness of fluorine-18-fluorodeoxyglucose positron emission tomography (FDG-PET) in patients with Hodgkin`s lymphoma (HL) with unconfirmed complete remission (CRu) or partial remission (PR) after first-line treatment. Patients and Methods One hundred thirty patients with HL were prospectively studied. After treatment, all patients with CRu/PR were evaluated with FDG-PET. In addition, PET-negative patients were evaluated with standard follow-up, and PET-positive patients were evaluated with biopsies of the positive lesions. Local unit costs of procedures and tests were evaluated. Cost effectiveness was determined by evaluating projected annual economic impact of strategies without and with FDG-PET on HL management. Results After treatment, CRu/PR was observed in 50 (40.0%) of the 127 patients; the sensitivity, specificity, and positive and negative predictive values of FDG-PET were 100%, 92.0%, 92.3%, and 100%, respectively (accuracy of 95.9%). Local restaging costs without PET were $350,050 compared with $283,262 with PET, a 19% decrease. The incremental cost-effectiveness ratio is -$3,268 to detect one true case. PET costs represented 1% of total costs of HL treatment. Simulated costs in the 974 patients registered in the 2008 Brazilian public health care database showed that the strategy including restaging PET would have a total program cost of $56,498,314, which is $516,942 less than without restaging PET, resulting in a 1% cost saving. Conclusion FDG-PET demonstrated 95.9% accuracy in restaging for patients with HL with CRu/PR after first-line therapy. Given the observed probabilities, FDG-PET is highly cost effective and would reduce costs for the public health care program in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mechanisms regulating NADPH oxidase remain open and include the redox chaperone protein disulfide isomerase (PDI). Here, we further investigated PDI effects on vascular NADPH oxidase. VSMC transfected with wild-type PDI (wt-PDI) OF PDI mutated in all four redox cysteines (mut-PDI) enhanced (2.5-fold) basal cellular ROS production and membrane NADPH oxidase activity, with 3-fold increase in Nox1, but not Nox4 mRNA. However, further ROS production, NADPH oxidase activity and Nox1 mRNA increase triggered by angiotensin-II (AngII) were totally lost with PDI overexpression, suggesting preemptive Nox1 activation in such cells. PDI overexpression increased Nox4 mRNA after AngII stimulus, although without parallel ROS increase. We also show that Nox inhibition by the nitric oxide donor GSNO is independent of PDI. PDI silencing decreased specifically Nox1 mRNA and protein, confirming that PDI may regulate Nox1 at transcriptional level in VSMC. Such data further strengthen the role of PDI as novel NADPH oxidase regulator. (C) 2009 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: The development of newer diagnostic technologies has reduced the need for invasive electroencephalographic (EEG) studies in identifying the epileptogenic zone, especially in adult patients with mesial temporal lobe epilepsy and hippocampal sclerosis (MTLE-HS). OBJECTIVE: To evaluate ictal single photon emission computed tomography (SPECT) in the evaluation and treatment of patients with MTLE-HS. METHODS: MTLE patients were randomly assigned to those with (SPECT, n = 124) and without ictal SPECT (non-SPECT, n = 116) in an intent-to-treat protocol. Primary end points were the proportion of patients with invasive EEG studies, and those offered surgery. Secondary end points were the length of hospital stay and the proportion of patients with secondarily generalized seizures (SGS) during video-EEG, postsurgical seizure outcome, and hospital cost. RESULTS: The proportion of patients offered surgery was similar in the SPECT (85%) and non-SPECT groups (81%), as well as the proportion that had invasive EEG studies (27% vs 23%). The mean duration of hospital stay was 1 day longer for the SPECT group (P < 0.001). SGS occurred in 51% of the SPECT and 26% of the non-SPECT group (P < 0.001). The cost of the presurgical evaluation was 35% higher for the SPECT compared with the non-SPECT group (P < 0.001). The proportion of patients seizure-free after surgery was similar in the SPECT (59%) compared with non-SPECT group (54%). CONCLUSION: Ictal-SPECT did not add localizing value beyond what was provided by EEG-video telemetry and structural MRI that altered the surgical decision and outcome for MTLE-HS patients. Ictal-SPECT increased hospital stay was associated with increased costs and a higher chance of SGS during video-EEG monitoring. These findings support the notion that a protocol including ictal SPECT is equivalent to one without SPECT in the presurgical evaluation of adult patients with MTLE-HS.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose To describe the ictal technetium-99 m-ECD SPECT findings in polymicrogyria syndromes (PMG) during epileptic seizures. Methods We investigated 17 patients with PMG syndromes during presurgical workup, which included long-term video-electroencephalographic (EEG) monitoring, neurological and psychiatry assessments, invasive EEG, and the subtraction of ictal-interictal SPECT coregistered to magnetic resonance imaging (MRI) (SISCOM). Results The analysis of the PMG cortex, using SISCOM, revealed intense hyperperfusion in the polymicrogyric lesion during epileptic seizures in all patients. Interestingly, other localizing investigations showed heterogeneous findings. Twelve patients underwent epilepsy surgery, three achieved seizure-freedom, five have worthwhile improvement, and four patients remained unchanged. Conclusions Our study strongly suggests the involvement of PMG in seizure generation or early propagation. Both conventional ictal single-photon emission computed tomography (SPECT) and SISCOM appeared as the single contributive exam to suggest the localization of the epileptogenic zone. Despite the limited number of resective epilepsy surgery in our study (n=9), we found a strong prognostic role of SISCOM in predicting surgical outcome. This result may be of great value on surgical decision-making of whether or not the whole or part of the PMG lesion should be surgically resected.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to unravel the mechanisms by which interleukin (IL)-10, a potent pleiotropic cytokine, modulates alveolar bone homeostasis in C57BL/6 wild-type (WT) and IL-10 knockout (IL-10 KO) mice, evaluated at 8, 24, and 48 wk of age. Interleukin-10 KO mice presented significant alveolar bone loss when compared with WT mice, and this was not associated with changes in leukocyte counts or bacterial load. The levels of expression of messenger RNA (mRNA) for tumor necrosis factor-alpha (TNF-alpha), IL-1 beta, IL-6, transforming growth factor-beta (TGF-beta), receptor activator of nuclear factor kappa B ligand (RANKL), osteoprotegerin (OPG), and matrix metalloproteinase 13 (MMP13) were similar between both strains, whereas a significant decrease of tissue inhibitor of metalloproteinase 1 (TIMP1) mRNA expression was found at 48 wk in IL-10 KO mice. The osteoblast markers core binding factor alpha1 (CBFA1) and type I collagen (COL-I) were expressed at similar levels in both strains, whereas the levels of alkaline phosphatase (ALP) and osteocalcin (OCN), and those of the osteocyte markers phosphate-regulating gene endopeptidases (PHEX) and dentin matrix protein 1 (DMP1) were significantly lower in IL-10 KO mice. Our results demonstrate that the alveolar bone loss in the absence of IL-10 was associated with a reduced expression of osteoblast and osteocyte markers, an effect independent of microbial, inflammatory or bone-resorptive pathways.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Epileptic seizures are clinical manifestations of neuronal discharges characterized by hyperexcitability and/or hypersynchrony in the cortex and other subcortical regions. The pilocarpine (PILO) model of epilepsy mimics temporal lobe epilepsy (TLE) in humans. In the present study, we used a more selective approach: microinjection of PILO into the hilus of the dentate gyrus (H-PILO). Our main goal was to evaluate the behavioral and morphological alterations present in this model of TLE. Seventy-six percent of all animals receiving H-PILO injections had continuous seizures called status epilepticus (SE). A typical pattern of evolution of limbic seizures during the SE with a latency of 29.3 +/- 16.3 minutes was observed using an analysis of behavioral sequences. During the subsequent 30 days, 71% of all animals exhibited spontaneous recurrent seizures (SRSs) during a daily 8-hour videotaping session. These SRSs had a very conspicuous and characteristic pattern detected by behavioral sequences or neuroethological analysis. Only the animals that had SE showed positive Neo-Timm staining in the inner molecular layer of the dentate gyrus (sprouting) and reduced cell density in Ammon`s horn pyramidal cell subfield CA1. However, no correlation between the intensity of sprouting and the mean number and total number of SRSs was found. Additionally, using Fluoro-Jade staining, we observed neurodegeration in the hilus and pyramidal cell subfields CA3 and CM 24 hours after SE. These data indicate that H-PILO is a reliable, selective, efficient, low-mortality model that mimics the acute and chronic behavioral and morphological aspects of TLE. (C) 2010 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cannabinoids have been shown to modulate central autonomic regulation and baroreflex control of blood pressure. Both CB1 and CB2 cannabinoid receptors have been described in the nucleus tractus solitarius (NTS), which receives direct afferent projections of cardiovascular reflexes. in the present study we evaluated the effects of WIN 55212-2 (WIN), a cannabinoid agonist, on fast neurotransmission in the NTS. We recorded spontaneous post-synaptic currents using the whole-cell configuration in NTS cells in brainstem slices from young rats (25-30 days old). Application of 5 mu M WIN inhibited the frequency of both glutamatergic and GABAergic sPSCs, without affecting their amplitudes. Effects of WIN were not blocked by application of the CB1 antagonist AM251, the CB2 antagonist AM630 or the varmiloid receptor TRPV1 antagonist AMG9810, suggesting that the effect of WIN is via a non-CB1 non-CB2 receptor. Neither the CB1/CB2 agonist HU210 nor the CB1 agonist ACPA affected the frequency of sPSCs. We conclude WIN inhibits the neurotransmission in the NTS of young rats via a receptor distinct from CB1 or CB2. (c) 2008 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objectives: To assess the vestibular fold muscle after cordectomy and laryngeal reconstruction, the pattern of motor unit recruitment during sound emission, and the morphologic characteristics of motor unit action potentials. Design: Prospective analysis. Setting: Tertiary academic hospital. Patients: We evaluated 11 men (mean age, 65.7 years; age range, 53-82 years) who underwent laryngofissure, cordectomy, and laryngeal reconstruction with a vestibular fold flap. Interventions: Laryngeal electromyography with the insertion of a needle electrode for the assessment of the electrophysiologic activity of thyroartenoid muscle fibers and of the cricothyroid muscle on the operated on and nonoperated on sides. The thyroarytenoid muscle was evaluated by introducing a needle electrode through the thyroid cartilage and the cricothyroid membrane. Main Outcome Measures: Activities of needle insertion, spontaneous muscle activity during rest, and pattern of motor unit recruitment. Results: Seven patients (64%) had vestibular fold muscle fiber, all of whom showed motor unit recruitment in response to sound emission. No neurogenic muscle injuries were observed except in 1 patient with evidence of chronic injury. Conclusion: After cordectomy and laryngeal reconstruction, thyroarytenoid muscle fibers are present in the vestibular fold, with motor unit recruitment during sound emission.