Bis- and tris-(3-aminopropyl) derivatives of 14-membered tetraazamacrocycles containing pyridine: synthesis, protonation and complexation studies

New N-(3-aminopropyl) (L-1, L-2) and (2-cyanoethyl) (L-3, L-4) derivatives of a 14-membered tetraazamacrocycle containing pyridine have been synthesized. The protonation constants of L-1 and L-2 and the stability constants of their complexes with Ni2+, Cu2+, Zn2+ and Cd2+ metal ions were determined in aqueous solutions by potentiometry, at 298.2 K and ionic strength 0.10 mol dm(-3) in KNO3. Both compounds have high overall basicity due to the presence of the aminopropyl arms. Their copper(II) complexes exhibit very high stability constants, which sharply decrease for the complexes of the other studied metal ions, as usually happens with polyamine ligands. Mono- and dinuclear complexes are formed with L-2 as well as with L-1, but the latter exhibits mononuclear complexes with slightly higher K-ML values while the dinuclear complexes of L-2 are thermodynamically more stable. The presence of these species in solution was supported by UV-VIS-NIR and EPR spectroscopic data. The single crystal structures of [Cu(H2L2)(ClO4)](3+) and [(CoLCl)-Cl-3](+) revealed that the metal centres are surrounded by the four nitrogen atoms of the macrocycle and one monodentate ligand, adopting distorted square pyramidal geometries. In the [(CoLCl)-Cl-3](+) complex, the macrocycle adopts a folded arrangement with the nitrogen atom opposite to the pyridine at the axial position while in the [Cu(H2L2)(ClO4)](3+) complex, the macrocycle adopts a planar conformation with the three aminopropyl arms located at the same side of the macrocyclic plane.

Studies on the parallel synthesis and evaluation of new heterocyclic extractants for the partitioning of minor actinides

Multiple parallel synthesis and evaluation have been combined in order to identify new nitrogen heterocycles for the partitioning of minor actinides(III) such as americium(III) from lanthanides such as europium(Ill). An array of triazine-containing molecules was made using multiple parallel syntheses from diketones and amide hydrazides. An excess of each of the resulting purified reagents was dissolved in 1,1,2,2-tetrachloroethane containing 2-bromodecanoic acid, and equilibrated with an aqueous solution containing the radiotracers Eu-152 and Am-241 in nitric acid ([Eu] + [Am] < 400 nanomol dm(-3)). Gamma counting of the organic and aqueous phases led to the identification of several new reagents for the selective extraction of americium(III). In particular, 6-(2-pyridyl)-2-(5,6-dialkyl-1,2,4-triazaphenyl)pyridines were found to be effective reagents for the separation of americium(III) from europium(III), (SFAm/Eu was ca. 30 in [HNO3] = 0.013 mol/L).

Extraction and coordination studies of the unexplored bifunctional ligand carbamoyl methyl sulfoxide (CMSO) with uranium(VI) and cerium(III) nitrates. Synthesis and structures of [UO2(NO3)(2)((PhSOCH2CONBu2)-Bu-i)] and [Ce(NO3)(3)(PhSOCH2CONBu2)(2)]

The bifunctional carbamoyl methyl sulfoxide ligands, PhCH2SOCH2CONHPh (L-1), PhCH2SOCH2CONHCH2Ph (L-2), (PhSOCH2CONPr2)-Pr-i (L-3), PhSOCH2CONBu2 (L-4), (PhSOCH2CONBu2)-Bu-i (L-5) and PhSOCH2CON(C8H17)(2) (L-6) have been synthesized and characterized by spectroscopic methods. The selected coordination chemistry of L-1, L-3, L-4 and L-5 with [UO2(NO3)(2)] and [Ce(NO3)(3)] has been evaluated. The structures of the compounds [UO2(NO3)(2)((PhSOCH2CONBu2)-Bu-i)] (10) and [Ce(NO3)(3)(PhSOCH2CONBu2)(2)] (12) have been determined by single crystal X-ray diffraction methods. Preliminary extraction studies of ligand L-6 with U(VI), Pu(IV) and Am(III) in tracer level showed an appreciable extraction for U(VI) and Pu(IV) in up to 10 M HNO3 but not for Am(III). Thermal studies on compounds 8 and 10 in air revealed that the ligands can be destroyed completely on incineration. The electron spray mass spectra of compounds 8 and 10 in acetone show that extensive ligand distribution reactions occur in solution to give a mixture of products with ligand to metal ratios of 1 : 1 and 2 : 1. However, 10 retains its solid state structure in CH2Cl2.

Interactions of an anionic surfactant with poly(oxyalkylene) copolymers in aqueous solution

The interactions of sodium dodecyl sulfate (SDS) with poly(ethylene oxide)/poly(alkylene oxide) (E/A) block copolymers are explored in this study: With respect to the specific compositional characteristics of the copolymer, introduction of SDS can induce fundamentally different effects to the self-assembly behavior of E/A copolymer solutions. In the case of the E18B10-SDS system (E = poly(ethylene oxide) and B = poly(butylene oxide)) development of large surfactant-polymer aggregates was observed. In the case of B20E610-SDS, B12E227B12-SDS, E40B10E40-SDS, E19P43E19-SDS (P = poly(propylene oxide)), the formation of smaller particles compared to pure polymeric micelles points to micellar suppression induced by the ionic surfactant. This effect can be ascribed to a physical binding between the hydrophobic block of unassociated macromolecules and the non-polar tail of the surfactant. Analysis of critical micelle concentrations (cmc*) of polymer-surfactant aqueous solutions within the framework of regular solution theory for binary surfactants revealed negative deviations from ideal behavior for E40B10E40-SDS and E19P43E19-SDS, but positive deviations for E18B10-SDS. Ultrasonic studies performed for the E19P43E19-SDS system enabled the identification of three distinct regions, corresponding to three main steps of the complexation; SDS absorption to the hydrophobic backbone of polymer, development of polymer-surfactant complexes and gradual breakdown of the mixed aggregates. (C) 2008 Elsevier Inc. All rights reserved.

Ditopic hexaazamacrocycles containing pyridine: synthesis, protonation and complexation studies

Structural studies of metal complexes of five ditopic hexaazamacrocycles containing two pyridine rings ([n] py(2)N(4) n = 18, 20, 22, 24 and 26) have been carried out. The synthesis of macrocycles [22]- to [26]- py(2)N(4) are also reported. The protonation constants of the last three compounds and the stability constants of their complexes with Ni2+, Cu2+, Zn2+, and Pb2+ were determined at 25 degreesC in 0.10 mol dm(-3) KNO3 in aqueous solution. Our results with [22] py(2)N(4) show significant differences from those described previously, while [24] py(2)N(4) has not been studied before and [ 26] py2N4 is a new compound. Mononuclear and dinuclear complexes of the divalent metal ions studied with [ 22]- to [26]- py(2)N(4) were found in solution. The stability constants for the ML complexes of the three ligands follow the Irving - Williams order: NiL2+ < CuL2+ >> ZnL2+ > PbL2+, however for the dinuclear complexes the values for Pb2+ complexes are higher than the corresponding values for the Ni2+ and the Zn2+ complexes. The X-ray single crystal structures of the supramolecular aggregates [Cu-2([20] py(2)N(4))(H2O)(4)][Cu(H2O)(6)](SO4)(3) . 3H(2)O ( 1) and [Cu-2([20] py(2)N(4))(CH3CN)(4)][Ni([20] py(2)N(4))](2)(ClO4)(8) . H2O (2), which are composed of homodinuclear [Cu-2([20] py(2)N(4)])(H2O)(4)](4+) ( 1a) and [Cu-2([20] py(2)N(4)])(CH3CN))(4)](4+) (2a), and mononuclear species, [Cu(H2O)(6)](2+) (1b) and [Ni([20] py(2)N(4))](2+) ( 2b), respectively, assembled by an extensive network of hydrogen bonds, are also reported. In both homodinuclear complexes the copper centres are located at the end of the macrocycle and display distorted square pyramidal coordination environments with the basal plane defined by three consecutive nitrogen donors and one solvent molecule, water in 1a and acetonitrile in 2a. The macrocycle adopts a concertina-type conformation leading to the formation of macrocyclic cavities with the two copper centres separated by intramolecular distances of 5.526(1) and 5.508(7) Angstrom in 1a and 2a, respectively. The mononuclear complex [Ni([20] py(2)N(4)])](2+) displays a distorted octahedral co-ordination environment with the macrocycle wrapping the metal centre in a helical shape. EPR spectroscopy of the copper complexes indicated the presence of mono- and dinuclear species.

New dioxadiaza- and trioxadiaza-macrocycles containing one dibenzofuran unit with two amino pendant arms: synthesis, protonation and complexation studies

New dioxadiaza- and trioxadiaza-macrocycles containing one rigid dibenzofuran unit (DBF) and N-(2-aminoethyl) pendant arms were synthesized, N,N'-bis(2-aminoethyl)-[17]( DBF) N2O2 (L-1) and N,N'-bis(2-aminoethyl)-[22](DBF)N2O3 (L-2), respectively. The binding properties of both macrocycles to metal ions and structural studies of their metal complexes were carried out. The protonation constants of both compounds and the stability constants of their complexes with Co2+, Ni2+, Cu2+, Zn2+, Cd2+, and Pb2+ were determined at 298.2 K, in aqueous solutions, and at ionic strength 0.10 mol dm(-3) in KNO3. Mononuclear complexes with both ligands were formed, and dinuclear complexes were only found for L-2. The thermodynamic binding affinities of the metal complexes of L-2 are lower than those of L-1 as expected, but the Pb2+ complexes of both macrocycles exhibit close stability constant values. On the other hand, the binding affinities of Cd2+ and Pb2+ for L-1 are very high, when compared to those of Co2+, Ni2+ and Zn2+. These interesting properties were explained by the presence of the rigid DBF moiety in the backbone of the macrocycle and to the special match between the macrocyclic cavity size and the studied larger metal ions. To elucidate the adopted structures of complexes in solution, the nickel(II) and copper( II) complexes with both ligands were further studied by UV-vis-MR spectroscopy in DMSO-H2O 1 : 1 (v/v) solution. The copper(II) complexes were also studied by EPR spectroscopy in the same mixture of solvents. The crystal structure of the copper complex of L-1 was also determined. The copper(II) displays an octahedral geometry, the four nitrogen atoms forming the equatorial plane and two oxygen atoms, one from the DBF unit and the other one from the ether oxygen, in axial positions. One of the ether oxygens of the macrocycle is out of the coordination sphere. Our results led us to suggest that this geometry is also adopted by the Co2+ to Zn2+ complexes, and only the larger Cd2+ and Pb2+ manage to form complexes with the involvement of all the oxygen atoms of the macrocyclic backbone.

Oxovanadium(V) complexes of bis(phenolate) ligands with acetylacetone as co-ligand: synthesis, crystal structure, electrochemical and kinetics studies on the oxidation of ascorbic acid

Two vanadium(V) complexes, [VO(L-1)]acac)] (1) and [VO(L-2)(acac)] (2), where H2L1 = N,N-bis(2-hydroxy-3-5-di-tert-butyl-benzyl)propylamine and H2L2 = 2,2'-selenobis(4,6-di-tert-butylphenol), have been synthesized and characterized by elemental analyses, IR, V-51 NMR, both in the solid and in solution, and cyclic voltammetric studies. Single crystal X-ray studies reveal that in complex 1 the vanadium atom is octahedrally coordinated with an O5N donor environment, where the oxygen atom of the V-V=O moiety and the N atom of the ONO ligand occupy the axial sites while two oxygen atoms (O1 and O2) from the bisphenolate ligand and two oxygen atoms (O3 and O4) from the acac ligand occupy the equatorial plane. A similar bonding pattern has also been encountered for 2 with the exception that a Se atom instead of N is involved in weak bonding to the metal center. Both complexes showed reversible cyclic voltammeric responses and E-1/2 appears at -0.18 and 0.10 V versus NHE for complexes 1 and 2, respectively. The kinetics of oxidation of ascorbic acid by complex 1 were carried out in 50% MeCN-50% HO (v/v) at 25 degrees C. The high formation constant value, Q = 63 +/- 7 M-1, reveals that the reaction proceeds through the rapid formation of a H-bonded intermediate. The low k(2)Q(2)/k(1)Q(1) ratio (13.4) for 1 points out that there is extensive H-bonding between the oxygen atom of the V-V=O group and the OH group of ascorbic acid. (c) 2007 Published by Elsevier Ltd.

Structural studies on acridine derivatives binding to telomeric DNA

Acridine derivatives can inhibit a variety of nuclear enzymes by binding or intercalating to DNA. This class of compounds is of great interest in the development of novel anticancer agents. Despite the availability of crystallographic data for some of the compounds complexed with DNA, uncertainties remain about the mechanisms of action, binding preferences and biological targets. To investigate the intercalation of several acridine derivatives, a variety of techniques are being employed. Single-crystal X-ray diffraction is being used to determine the high resolution three-dimensional structure of short sequences of quadruplex telomeric DNA with bound drug. This will be compared to the effect of drug binding to long segments of double-stranded DNA using fibre diffraction, with neutron diffraction studies planned to analyse the hydrogen bonding patterns of the DNA-drug complexes. Small-angle neutron scattering (SANS) will also be applied to study drug binding to both short and long sequences of quadruplex and double-stranded DNA in solution. Initial SANS measurements of the telomeric repeat d(TGGGGT) imply that this hexamer is present as a quadruplex. (c) 2006 Elsevier B.V. All rights reserved.

Chemical, electrochemical and structural studies of some cis-dioxomolybdenum(VI) complexes of two tridentate ONS chelating ligands

Several cis-dioxomolybdenum complexes of two tridentate ONS chelating ligands H2L1 and H2L2 ( obtained by condensation of S-benzyl and S-methyl dithiocarbazates with 2-hydroxyacetophenone) have been prepared and characterized. Complexes 1 and 2 are found to be of the form MoO2 (CH3OH)L-1.CH3OH and MoO2L, respectively, (where L2-=dianion of H2L1 and H2L2). The sixth coordination site of the complexes acts as a binding site for various neutral monodentate Lewis bases, B, forming complexes 3 - 10 of the type MoO2LB (where B=gamma-picoline, imidazole, thiophene, THF). The complexes were characterized by elemental analyses, various spectroscopic techniques, ( UV-Vis, IR and H-1 NMR), measurement of magnetic susceptibility at room temperature, molar conductivity in solution and by cyclic voltammetry. Two of the complexes MoO2(CH3OH)L-1.CH3OH (1) and MoO2L1(imz) (5) were structurally characterized by single crystal X-ray diffraction. Oxo abstruction reactions of 1 and 5 led to formation of oxomolybdenum(IV) complex of the MoOL type.

Cyclam derivatives containing three acetate pendant arms: synthesis, acid-base, metal complexation and structural studies

The ligands 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic-11-methylphosphonic acid (H(5)te3a1p) and 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic acid (H(3)te3a) were synthesized, the former one for the first time. The syntheses of these ligands were achieved from reactions on 1,4,8,11-tetraazacyclotetradecane-1,4,8-tris( carbamoylmethyl) hydroiodide (te3am center dot HI), and compounds (Hte3am)(+), 1, and (H(7)te3a1p)(2+), 4, were characterized by X-ray diffraction. Structures of two other compounds resulting from side-reactions, (H(2)te2lac)(2+), 2, and (H(4)te2a2p(OEt2))(2+), 3, were also determined by X-ray diffraction. Potentiometric titrations of H(5)te3a1p and H(3)te3a were performed at 298.2 K and ionic strength 0.10 mol dm(-3) in NMe4NO3 to determine their protonation constants. H-1 and P-31 NMR titrations of H(5)te3a1p were carried out in order to determine the very high first protonation constant of this ligand and to elucidate the sequence of protonation. Potentiometric studies of the two ligands with Ca2+, Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+ and Pb2+ metal ions performed in the same experimental conditions showed that the complexes of H5te3a1p present very high thermodynamic stability while complexes of H(3)te3a, particularly Co2+ and Zn2+, are even more stable. P-31 NMR spectra of the cadmium(II) complex of H(5)te3a1p showed that the phosphonate moiety was coordinated to the metal ion. The UV-vis-NIR spectroscopic data and magnetic moment values of Co2+ and Ni2+ complexes of H(5)te3a1p and H(3)te3a together with the EPR of the corresponding Cu2+ complexes indicated that all these complexes adopt distorted octahedral coordination geometries in solution. This was confirmed by the single crystal structure of [Cu-2(Hte3a)(H2O)(3)Cl]Cl-0.5(ClO4)(0.5) center dot 2H(2)O that showed two distorted octahedral copper centres bridged by a N-acetate pendant arm with a Cu center dot center dot center dot Cu distance of 4.890(1) angstrom. The first one is encapsulated into the macrocyclic cavity surrounded by four nitrogen and two oxygen donors from the macrocycle, whereas the second one is on the periphery of the macrocycle and is coordinated to two oxygen atoms of one acetate pendant arm in chelating fashion, one chloride and three water molecules.

Modelling oil absorption during post-frying cooling - II: solution of the mathematical model, model testing and simulations

The mathematical models that describe the immersion-frying period and the post-frying cooling period of an infinite slab or an infinite cylinder were solved and tested. Results were successfully compared with those found in the literature or obtained experimentally, and were discussed in terms of the hypotheses and simplifications made. The models were used as the basis of a sensitivity analysis. Simulations showed that a decrease in slab thickness and core heat capacity resulted in faster crust development. On the other hand, an increase in oil temperature and boiling heat transfer coefficient between the oil and the surface of the food accelerated crust formation. The model for oil absorption during cooling was analysed using the tested post-frying cooling equation to determine the moment in which a positive pressure driving force, allowing oil suction within the pore, originated. It was found that as crust layer thickness, pore radius and ambient temperature decreased so did the time needed to start the absorption. On the other hand, as the effective convective heat transfer coefficient between the air and the surface of the slab increased the required cooling time decreased. In addition, it was found that the time needed to allow oil absorption during cooling was extremely sensitive to pore radius, indicating the importance of an accurate pore size determination in future studies.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Nickel(II) and copper(II) complexes of Schiff base ligands containing N4O2 and N4S2 donors with pyrrole terminal binding groups: synthesis, characterization, X-ray structures, DFT and electrochemical studies

A series of hexadentate ligands, H2Lm (m = 1−4), [1H-pyrrol-2-ylmethylene]{2-[2-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)ethoxy]phenyl}amine (H2L1), [1H-pyrrol-2-ylmethylene]{2-[4-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)butoxy]phenyl}amine (H2L2), [1H-pyrrol-2-ylmethylene][2-({2-[(2-{[1H-pyrrol-2-ylmethylene]amino}phenyl)thio]ethyl}thio)phenyl]amine (H2L3) and [1H-pyrrol-2-ylmethylene][2-({4-[(2-{[1H-pyrrol-2-lmethylene]amino}phenyl)thio]butyl}thio) phenyl]amine (H2L4) were prepared by condensation reaction of pyrrol-2-carboxaldehyde with {2-[2-(2-aminophenoxy)ethoxy]phenyl}amine, {2-[4-(2-aminophenoxy)butoxy]phenyl}amine, [2-({2-[(2-aminophenyl)thio]ethyl}thio)phenyl]amine and [2-({4-[(2-aminophenyl)thio]butyl}thio)phenyl]amine respectively. Reaction of these ligands with nickel(II) and copper(II) acetate gave complexes of the form MLm (m = 1−4), and the synthesized ligands and their complexes have been characterized by a variety of physico-chemical techniques. The solid and solution states investigations show that the complexes are neutral. The molecular structures of NiL3 and CuL2, which have been determined by single crystal X-ray diffraction, indicate that the NiL3 complex has a distorted octahedral coordination environment around the metal while the CuL2 complex has a seesaw coordination geometry. DFT calculations were used to analyse the electronic structure and simulation of the electronic absorption spectrum of the CuL2 complex using TDDFT gives results that are consistent with the measured spectroscopic behavior of the complex. Cyclic voltammetry indicates that all copper complexes are electrochemically inactive but the nickel complexes with softer thioethers are more easily oxidized than their oxygen analogs.

Linking energy and maintenance management for sustainability through three American case studies

Purpose – The purpose of this paper is to present the findings and lessons learned from three case studies conducted for facilities located in California, North America. The findings aim to focus on energy and maintenance management practices and the interdependent link between energy and maintenance. Design/methodology/approach – The research is based on a positivist epistemological philosophical approach informed by action research. The research cycle was completed for each case study. A case study report was provided to each facility management team to foster collaboration with the researcher and to document case study process and results. Findings – Composite findings of the case studies include: there is an interdependent link between energy and maintenance management; reactive maintenance and energy management methods are commonly used; and more proactively operated and managed buildings require the interdependent link between energy maintenance management to be better understood. Research limitations/implications – The three case studies were located in California. Although the case study results can be generalized, determination of how to generalize and apply the results to commercial buildings outside of the USA is beyond the scope of this paper. Practical implications – Detailed discussion of the needs of the three facility management teams are discussed by identifying a current challenge, developing a solution and documenting lessons learned using the research cycle. Originality/value – The paper seeks to demonstrate the interdependencies of energy and maintenance management, two topics which are often researched interdependently. Additionally, the paper provides insight about maintenance management, a topic often cited as being under researched.

Steric effects on uranyl complexation: synthetic, structural, and theoretical studies of carbamoyl pyrazole compounds of the uranyl(VI) ion

New bifunctional pyrazole based ligands of the type [C3HR2N2CONR'] (where R = H or CH3; R' = CH3, C2H5, or (C3H7)-C-i) were prepared and characterized. The coordination chemistry of these ligands with uranyl nitrate and uranyl bis(dibenzoyl methanate) was studied with infrared (IR), H-1 NMR, electrospray-mass spectrometry (ES-MS), elemental analysis, and single crystal X-ray diffraction methods. The structure of compound [UO2(NO3)(2)(C3H3N2CON{C2H5}(2))] (2) shows that the uranium(VI) ion is surrounded by one nitrogen atom and seven oxygen atoms in a hexagonal bipyramidal geometry with the ligand acting as a bidentate chelating ligand and bonds through both the carbamoyl oxygen and pyrazolyl nitrogen atoms. In the structure of [UO2(NO3)(2)(H2O)(2)(C5H7N2CON {C2H5}(2))(2)], (5) the pyrazole figand acts as a second sphere ligand and hydrogen bonds to the water molecules through carbamoyl oxygen and pyrazolyl nitrogen atoms. The structure of [UO2(DBM)(2)C3H3N2CON{C2H5}(2)] (8) (where DBM = C6H5COCHCOC6H5) shows that the pyrazole ligand acts as a monodentate ligand and bonds through the carbamoyl oxygen to the uranyl group. The ES-MS spectra of 2 and 8 show that the ligand is similarly bonded to the metal ion in solution. Ab initio quantum chemical studies show that the steric effect plays the key role in complexation behavior.