Probe-specific mixed-model approach to detect copy number differences using multiplex ligation-dependent probe amplification (MLPA)

Background: MLPA method is a potentially useful semi-quantitative method to detect copy number alterations in targeted regions. In this paper, we propose a method for the normalization procedure based on a non-linear mixed-model, as well as a new approach for determining the statistical significance of altered probes based on linear mixed-model. This method establishes a threshold by using different tolerance intervals that accommodates the specific random error variability observed in each test sample.Results: Through simulation studies we have shown that our proposed method outperforms two existing methods that are based on simple threshold rules or iterative regression. We have illustrated the method using a controlled MLPA assay in which targeted regions are variable in copy number in individuals suffering from different disorders such as Prader-Willi, DiGeorge or Autism showing the best performace.Conclusion: Using the proposed mixed-model, we are able to determine thresholds to decide whether a region is altered. These threholds are specific for each individual, incorporating experimental variability, resulting in improved sensitivity and specificity as the examples with real data have revealed.

Validation of a Low-Cost Human Papillomavirus Genotyping Assay Based on PGMY PCR and Reverse Blotting Hybridization with Reusable Membranes.

The genotyping of human papillomaviruses (HPV) is essential for the surveillance of HPV vaccines. We describe and validate a low-cost PGMY-based PCR assay (PGMY-CHUV) for the genotyping of 31 HPV by reverse blotting hybridization (RBH). Genotype-specific detection limits were 50 to 500 genome equivalents per reaction. RBH was 100% specific and 98.61% sensitive using DNA sequencing as the gold standard (n = 1,024 samples). PGMY-CHUV was compared to the validated and commercially available linear array (Roche) on 200 samples. Both assays identified the same positive (n = 182) and negative samples (n = 18). Seventy-six percent of the positives were fully concordant after restricting the comparison to the 28 genotypes shared by both assays. At the genotypic level, agreement was 83% (285/344 genotype-sample combinations; κ of 0.987 for single infections and 0.853 for multiple infections). Fifty-seven of the 59 discordant cases were associated with multiple infections and with the weakest genotypes within each sample (P < 0.0001). PGMY-CHUV was significantly more sensitive for HPV56 (P = 0.0026) and could unambiguously identify HPV52 in mixed infections. PGMY-CHUV was reproducible on repeat testing (n = 275 samples; 392 genotype-sample combinations; κ of 0.933) involving different reagents lots and different technicians. Discordant results (n = 47) were significantly associated with the weakest genotypes in samples with multiple infections (P < 0.0001). Successful participation in proficiency testing also supported the robustness of this assay. The PGMY-CHUV reagent costs were estimated at $2.40 per sample using the least expensive yet proficient genotyping algorithm that also included quality control. This assay may be used in low-resource laboratories that have sufficient manpower and PCR expertise.

Detection of CBP rearrangements in acute myelogenous leukemia with t(8;16).

The CREB-binding protein (CBP) is a large nuclear protein that regulates many signal transduction pathways and is involved in chromatin-mediated transcription. The translocation t(8;16)(p11;p13.3) consistently disrupts two genes: the CBP gene on chromosome band 16p13.3 and the MOZ gene on chromosome band 8p11. Although a fusion of these two genes as a result of the translocation is expected, attempts at detecting the fusion transcript by reverse transcriptase polymerase chain reaction (RT-PCR) have proven difficult; to date, only one in-frame CBP/MOZ fusion transcript has been reported. We therefore sought other reliable means of detecting CBP rearrangements. We applied fluorescence in situ hybridization (FISH) and Southern blot analyses to a series of AML patients with a t(8;16) and detected DNA rearrangements of both the CBP and the MOZ loci in all cases tested. All six cases examined for CBP rearrangements have breakpoints within a 13 kb breakpoint cluster region at the 5' end of the CBP gene. Additionally, we used a MOZ cDNA probe to construct a surrounding cosmid contig and detect DNA rearrangements in three t(8;16) cases, all of which display rearrangements within a 6 kb genomic fragment of the MOZ gene. We have thus developed a series of cosmid probes that consistently detect the disruption of the CBP gene in t(8;16) patients. These clones could potentially be used to screen other cancer-associated or congenital translocations involving chromosome band 16p13.3 as well.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Electron probe microanalysis: principles and applications

This article summarizes the basic principles of electron probe microanalysis, with examples of applications in materials science and geology that illustrate the capabilities of the technique.

Ecological niche overlap in sister species: how do oil-collecting bees Macropis europaea and M. fulvipes (Hymenoptera: Melittidae) avoid competition and hybridization?

Oil-collecting bees are found worldwide and always in association with particular oil-producing flowers. In the Western Palearctic, three oil-collecting bee species within the genus Macropis (Hymenoptera, Melittidae) interact in a tight pollination mutualism with species of the only European oil-producing plant genus Lysimachia L. (Myrsinaceae). Two of these oil-collecting bees (Macropis europaea and Macropis fulvipes) show overlapping geographic distributions, comparable morphologies, and similar ecological characteristics (e.g., habitat type, floral preferences). In view of these similarities, we presume that hybridization should occur between the two species unless potential variation among the species' ecological niches prevents it, simultaneously decreasing competition for resources. Using modern genetic analyses and ecological niche modeling on a large bee sampling throughout Europe, we discuss new perspectives on the ecology and evolutionary history of this mutualism.

Somatic hybridization between Citrus sinensis (L.) Osbeck and C. grandis (L.) Osbeck

This work had as objective to produce citrus somatic hybrids between sweet oranges and pummelos. After chemical fusion of sweet orange embryogenic protoplasts with pummelo mesophyll-derived protoplasts, plants were regenerated by somatic embryogenesis and acclimatized in a greenhouse. The hybrids of 'Hamlin' sweet orange + 'Indian Red' pummelo and 'Hamlin' sweet orange + 'Singapura' pummelo were confirmed by leaf morphology, chromosome counting and molecular analysis. These hybrids have potential to be used directly as rootstocks aiming blight, citrus tristeza virus, and Phytophthora-induced disease tolerance, as well as for rootstocks improvement programs.

CleanEx: a database of heterogeneous gene expression data based on a consistent gene nomenclature.

The main goal of CleanEx is to provide access to public gene expression data via unique gene names. A second objective is to represent heterogeneous expression data produced by different technologies in a way that facilitates joint analysis and cross-data set comparisons. A consistent and up-to-date gene nomenclature is achieved by associating each single experiment with a permanent target identifier consisting of a physical description of the targeted RNA population or the hybridization reagent used. These targets are then mapped at regular intervals to the growing and evolving catalogues of human genes and genes from model organisms. The completely automatic mapping procedure relies partly on external genome information resources such as UniGene and RefSeq. The central part of CleanEx is a weekly built gene index containing cross-references to all public expression data already incorporated into the system. In addition, the expression target database of CleanEx provides gene mapping and quality control information for various types of experimental resource, such as cDNA clones or Affymetrix probe sets. The web-based query interfaces offer access to individual entries via text string searches or quantitative expression criteria. CleanEx is accessible at: http://www.cleanex.isb-sib.ch/.

Diradicals acting through diamagnetic phenylene vinylene bridges: Raman spectroscopy as a probe to characterize spin delocalization

We present a complete Raman spectroscopic study in two structurally well-defined diradical species of different lengths incorporating oligo p-phenylene vinylene bridges between two polychlorinated triphenylmethyl radical units, a disposition that allows sizeable conjugation between the two radicals through and with the bridge. The spectroscopic data are interpreted and supported by quantum chemical calculations. We focus the attention on the Raman frequency changes, interpretable in terms of: (i) bridge length (conjugation length); (ii) bridge conformational structure; and (iii) electronic coupling between the terminal radical units with the bridge and through the bridge, which could delineate through-bond spin polarization, or spin delocalization. These items are addressed by using the"oligomer approach" in conjunction with pressure and temperature dependent Raman spectroscopic data. In summary, we have attempted to translate the well-known strategy to study the electron (charge) structure of π−conjugated molecules by Raman spectroscopy to the case of electron (spin) interactions via the spin delocalization mechanism.

Genetic aberrations in pediatric follicular lymphoma

Background: Pediatric follicular lymphoma (FL) is a rare disease that differs from its adult counterpart both genetically and clinically. Excluding pediatric FL with IRF4-translocation, the genetic events associated with pediatric FL have not yet been defined. Objectives: The aim of this study was to perform a complete genetic characterization of IRF4-translocation negative pediatric follicular lymphomas to elucidate the genetic profile of these rare pediatric cases and determine common genetic alterations that could be associated to this phenotype. Design/Methods: We applied array-comparative genomic hybridization and molecular inversion probe assay adapted to formalin-fixed paraffin-embedded tissues from 18 patients aged £18 years diagnosed with FL. With the exception of one case with only focal involvement by lymphoma, the tumor cell content exceeded 50% in the evaluable samples. Eleven of 18 patients were treated according to NHL-BFM group multicenter trials whereas the remaining according to different protocols. All lacked t(14;18) translocation. Mutational analysis of TNFRSF14 gene was performed in 17 cases. Results: Only six pediatric cases displayed chromosomal imbalances, with gain/amplification of 6pter-p24.3 (including IRF4) and deletion/ copy number neutral-loss of heterozygosity in 1p36 (including TNFRSF14) being the most frequent alterations. Sequencing of the candidate gene TNFRSF14 at 1p36.32 showed nine mutations in seven cases. Conclusion: Combination of molecular and genetic features differentiated a recurrent pattern of genomic imbalances as well as of TNFRSF14 mutations in pediatric FL which together with other genetic alterations distinguishes two subsets of pediatric follicular lymphomas. The first group shows genomic aberrations and is associated with more aggressive histopathologic and clinical features. The second group lacks genetic alterations detectable with the present approaches and is associated with a more limited disease. Despite the absence of genomic aberrations, these cases resembled FL by their histopathological features.

CleanEx: a database of heterogeneous gene expression data based on a consistent gene nomenclature and linked to an improved annotation system

Résumé: L'automatisation du séquençage et de l'annotation des génomes, ainsi que l'application à large échelle de méthodes de mesure de l'expression génique, génèrent une quantité phénoménale de données pour des organismes modèles tels que l'homme ou la souris. Dans ce déluge de données, il devient très difficile d'obtenir des informations spécifiques à un organisme ou à un gène, et une telle recherche aboutit fréquemment à des réponses fragmentées, voir incomplètes. La création d'une base de données capable de gérer et d'intégrer aussi bien les données génomiques que les données transcriptomiques peut grandement améliorer la vitesse de recherche ainsi que la qualité des résultats obtenus, en permettant une comparaison directe de mesures d'expression des gènes provenant d'expériences réalisées grâce à des techniques différentes. L'objectif principal de ce projet, appelé CleanEx, est de fournir un accès direct aux données d'expression publiques par le biais de noms de gènes officiels, et de représenter des données d'expression produites selon des protocoles différents de manière à faciliter une analyse générale et une comparaison entre plusieurs jeux de données. Une mise à jour cohérente et régulière de la nomenclature des gènes est assurée en associant chaque expérience d'expression de gène à un identificateur permanent de la séquence-cible, donnant une description physique de la population d'ARN visée par l'expérience. Ces identificateurs sont ensuite associés à intervalles réguliers aux catalogues, en constante évolution, des gènes d'organismes modèles. Cette procédure automatique de traçage se fonde en partie sur des ressources externes d'information génomique, telles que UniGene et RefSeq. La partie centrale de CleanEx consiste en un index de gènes établi de manière hebdomadaire et qui contient les liens à toutes les données publiques d'expression déjà incorporées au système. En outre, la base de données des séquences-cible fournit un lien sur le gène correspondant ainsi qu'un contrôle de qualité de ce lien pour différents types de ressources expérimentales, telles que des clones ou des sondes Affymetrix. Le système de recherche en ligne de CleanEx offre un accès aux entrées individuelles ainsi qu'à des outils d'analyse croisée de jeux de donnnées. Ces outils se sont avérés très efficaces dans le cadre de la comparaison de l'expression de gènes, ainsi que, dans une certaine mesure, dans la détection d'une variation de cette expression liée au phénomène d'épissage alternatif. Les fichiers et les outils de CleanEx sont accessibles en ligne (http://www.cleanex.isb-sib.ch/). Abstract: The automatic genome sequencing and annotation, as well as the large-scale gene expression measurements methods, generate a massive amount of data for model organisms. Searching for genespecific or organism-specific information througout all the different databases has become a very difficult task, and often results in fragmented and unrelated answers. The generation of a database which will federate and integrate genomic and transcriptomic data together will greatly improve the search speed as well as the quality of the results by allowing a direct comparison of expression results obtained by different techniques. The main goal of this project, called the CleanEx database, is thus to provide access to public gene expression data via unique gene names and to represent heterogeneous expression data produced by different technologies in a way that facilitates joint analysis and crossdataset comparisons. A consistent and uptodate gene nomenclature is achieved by associating each single gene expression experiment with a permanent target identifier consisting of a physical description of the targeted RNA population or the hybridization reagent used. These targets are then mapped at regular intervals to the growing and evolving catalogues of genes from model organisms, such as human and mouse. The completely automatic mapping procedure relies partly on external genome information resources such as UniGene and RefSeq. The central part of CleanEx is a weekly built gene index containing crossreferences to all public expression data already incorporated into the system. In addition, the expression target database of CleanEx provides gene mapping and quality control information for various types of experimental resources, such as cDNA clones or Affymetrix probe sets. The Affymetrix mapping files are accessible as text files, for further use in external applications, and as individual entries, via the webbased interfaces . The CleanEx webbased query interfaces offer access to individual entries via text string searches or quantitative expression criteria, as well as crossdataset analysis tools, and crosschip gene comparison. These tools have proven to be very efficient in expression data comparison and even, to a certain extent, in detection of differentially expressed splice variants. The CleanEx flat files and tools are available online at: http://www.cleanex.isbsib. ch/.

Development of globular embryos from the hybridization between 'Pêra Rio' sweet orange and 'Poncã' mandarin

This research was undertaken to study the influence of different concentrations of the MT medium, sucrose, vitamins, activated charcoal and gibberellic acid (GA3) on the culture of immature embryos from the crossing between 'Pêra Rio' sweet orange and 'PONCÃ' mandarin. The embryos were excised under aseptic conditions and inoculated in 15 mL of the MT medium according to the following experiments: 1) MT concentrations (0%, 50%, 100%, 150% and 200%) supplemented with 0, 30, 60 and 90 g.L-1 of sucrose; 2) vitamins concentrations of the MT (0%, 50%, 100%, 150% and 200%) supplemented with 0, 30, 60 and 90 g.L-1 of sucrose; 3) activated charcoal concentrations (0, 0.5, 1, 1.5 and 2 g.L-1) supplemented with GA3 (0, 0.01, 0.1; 1 and 10 mg.L-1). After the inoculation, the embryos were kept in a growth room for 90 days at 27 ± 1ºC, in a 16-hour photoperiod with 32 µmol.m-2.s-1 of irradiance. The best development of embryos at the globular stage was achieved using 50% and 100% of the MT medium plus 60 g.L-1 and 90 g.L-1 of sucrose, respectively, supplemented with 0.01 mg.L-1 of GA3. The addition of activated charcoal or vitamins in the MT medium has shown to be unnecessary to the development of globular embryos.