T helper type 2 inflammatory disease in the absence of interleukin 4 and transcription factor STAT6

An important signaling pathway for the differentiation of T helper type 2 (TH2) cells from uncommitted CD4 T cell precursors is activation of the STAT6 transcription factor by interleukin 4 (IL-4). The protooncogene BCL-6 is also involved in TH2 differentiation, as BCL-6 −/− mice develop an inflammation of the heart and lungs associated with an overproduction of TH2 cells. Surprisingly, IL-4 −/− BCL-6 −/− and STAT6 −/− BCL-6 −/− double-mutant mice developed the same TH2-type inflammation of the heart and lungs as is characteristic of BCL-6 −/− mice. Furthermore, a TH2 cytokine response developed in STAT6 −/− BCL-6 −/− and IL-4 −/− BCL-6 −/− mice after immunization with a conventional antigen in adjuvant. In contrast to these in vivo findings, STAT6 was required for the in vitro differentiation of BCL-6 −/− T cells into TH2 cells. BCL-6, a transcriptional repressor that can bind to the same DNA binding motifs as STAT transcription factors, seems to regulate TH2 responses in vivo by a pathway independent of IL-4 and STAT6.

CpG DNA can induce strong Th1 humoral and cell-mediated immune responses against hepatitis B surface antigen in young mice

Successful neonatal immunization of humans has proven difficult. We have evaluated CpG-containing oligonucleotides as an adjuvant for immunization of young mice (1–14 days old) against hepatitis B virus surface antigen. The protein-alum-CpG formulation, like the DNA vaccine, produced seroconversion of the majority of mice immunized at 3 or 7 days of age, compared with 0–10% with the protein-alum or protein-CpG formulations. All animals, from neonates to adults, immunized with the protein-alum vaccine exhibited strong T helper (Th)2-like responses [predominantly IgG1, weak or absent cytotoxic T lymphocytes (CTL)]. Th2-type responses also were induced in young mice with protein-CpG (in 1-, 3-, and 7-day-old mice) and protein-alum-CpG (in 1- and 3-day-old mice) but immunization carried out at older ages gave mixed Th1/Th2 (Th0) responses. DNA vaccines gave Th0-like responses when administered at 1 and 7 days of age and Th1-like (predominantly IgG2a and CTL) responses with 14-day-old or adult mice. Surprisingly, the protein-alum-CpG formulation was better than the DNA vaccine for percentage of seroconversion, speed of appearance, and peak titer of the antibody response, as well as prevalence and strength of CTL. These findings may have important implications for immunization of human infants.

Genetic mapping of a murine locus controlling development of T helper 1/T helper 2 type responses.

Genetic background of the T cell can influence T helper (Th) phenotype development, with some murine strains (e.g., B10.D2) favoring Th1 development and others (e.g., BALB/c) favoring Th2 development. Recently we found that B10.D2 exhibit an intrinsically greater capacity to maintain interleukin 12 (IL-12) responsiveness under neutral conditions in vitro compared with BALB/c T cells, allowing for prolonged capacity to undergo IL-12-induced Th1 development. To begin identification of the loci controlling this genetic effect, we used a T-cell antigen receptor-transgenic system for in vitro analysis of intercrosses between BALB/c and B10.D2 mice and have identified a locus on murine chromosome 11 that controls the maintenance of IL-12 responsiveness, and therefore the subsequent Th1/Th2 response. This chromosomal region is syntenic with a locus on human chromosome 5q31.1 shown to be associated with elevated serum IgE levels, suggesting that genetic control of Th1/Th2 differentiation in mouse, and of atopy development in humans, may be expressed through similar mechanisms.

An essential role for Bruton's [corrected] tyrosine kinase in the regulation of B-cell apoptosis.

Mutations of the Bruton's tyrosine kinase (btk) gene cause X-linked agammaglobulinemia (XLA) in humans and X-linked immune deficiency (Xid) in mice. To establish the BTK role in B-cell activation we examined the responses of wild-type and Xid B cells to stimulation through surface IgM and CD40, the transducers of thymus independent-type 2 and thymus-dependent activation, respectively. Wild-type BTK was necessary for proliferation induced by soluble anti-IgM (a prototype for thymus independent-type 2 antigen), but not for responses to soluble CD40 ligand (CD40L, the B-cell activating ligand expressed on T-helper cells). In the absence of wild-type BTK, B cells underwent apoptotic death after stimulation with anti-IgM. In the presence of wild-type but not mutated BTK, anti-IgM stimulation reduced apoptotic cell death. In contrast, CD40L increased viability of both wild-type and Xid B cells. Importantly, viability after stimulation correlated with the induced expression of bcl-XL. In fresh ex vivo small resting B cells from wild-type mice there was only barely detectable bcl-XL protein, but there was more in the larger, low-density ("activated") splenic B cells and peritoneal B cells. In vitro Bcl-XL induction following ligation of sIgM-required BTK, was cyclosporin A (CsA)-sensitive and dependent on extracellular Ca2+. CD40-mediated induction of bcl-x required neither wild-type BTK nor extracellular Ca2+ and was insensitive to CsA. These results indicate that BTK lies upstream of bcl-XL in the sIgM but not the CD40 activation pathway. bcl-XL is the first induced protein to be placed downstream of BTK.

Local production of the p40 subunit of interleukin 12 suppresses T-helper 1-mediated immune responses and prevents allogeneic myoblast rejection.

The p40 subunit of interleukin 12 (IL-12p40) has been known to act as an IL-12 antagonist in vitro. We here describe the immunosuppressive effect of IL-12p40 in vivo. A murine myoblast cell line, C2C12, was transduced with retro-virus vectors carrying the lacZ gene as a marker and the IL-12p40 gene. IL-12p40 secreted from the transfectant inhibited the IL-12-induced interferon gamma (IFN-gamma) production by splenocytes in vitro. Survival of C2C12 transplanted into allogeneic recipients was substantially prolonged when transduced with IL-12p40. Cytokine (IL-2 and IFN-gamma) production and cytotoxic T lymphocyte induction against allogeneic C2C12 were impaired in the recipients transplanted with the IL-12p40 transfectant. Delayed-type hypersensitivity response against C2C12 was also diminished in the IL-12p40 recipients. Furthermore, serum antibodies against beta-galactosidase of the T-helper 1-dependent isotypes (IgG2 and IgG3) were decreased in the IL-12p40 recipients. These results indicate that locally produced IL-12p40 exerts a potent immunosuppressive effect on T-helper 1-mediated immune responses that lead to allograft rejection. Therefore, IL-12p40 gene transduction would be useful for preventing the rejection of allografts and genetically modified own cells that are transduced with potentially antigenic molecules in gene therapy.

Effects of TH1 and TH2 cytokines on CD8+ cell response against human immunodeficiency virus: implications for long-term survival.

CD8+ cells from long-term survivors [LTS; infected with human immunodeficiency virus (HIV) for 10 or more years and having CD4+ cell counts of > or = 500 cells per microliters] have a 3-fold greater ability to suppress HIV replication than do CD8+ cells from patients who have progressed to disease (progressors) during the same time period. A change in the pattern of cytokines produced in the host from those that typically favor cell-mediated immunity (T helper 1, TH1 or type 1) to those that down-regulate it (T helper 2, TH2 or type 2) was investigated as a cause of this reduced CD8+ cell anti-HIV function. Treatment of CD8+ cells from LTS with the TH1 cytokine interleukin (IL)-2 enhanced their anti-HIV activity, whereas exposure of these cells to TH2 cytokines IL-4 or IL-10 reduced their ability to suppress HIV replication and to produce IL-2. IL-2 could prevent and reverse the inhibitory effects of IL-4 and IL-10. Moreover, prolonged exposure of CD8+ cells from some progressors to IL-2 improved the ability of these cells to suppress HIV replication. These observations support previous findings suggesting that strong CD8+ cell responses play an important role in maintaining an asymptomatic state in HIV infection. The data suggest that the loss of CD8+ cell suppression of HIV replication associated with disease progression results from a shift in cytokine production within the infected host from a TH1 to a TH2 pattern. Modulation of these cytokines could provide benefit to HIV-infected individuals by improving their CD8+ cell anti-HIV activity.

Upregulation of class I major histocompatibility complex antigens by interferon gamma is necessary for T-cell-mediated elimination of recombinant adenovirus-infected hepatocytes in vivo.

Recombinant adenoviruses are attractive vehicles for liver-directed gene therapy because of the high efficiency with which they transfer genes to hepatocytes in vivo. First generation recombinant adenoviruses deleted of E1 sequences also express recombinant and early and late viral genes, which lead to development of destructive cellular immune responses. Previous studies indicated that class I major histocompatibility complex (MHC)-restricted cytotoxic T lymphocytes (CTLs) play a major role in eliminating virus-infected cells. The present studies utilize mouse models to evaluate the role of T-helper cells in the primary response to adenovirus-mediated gene transfer to the liver. In vivo ablation of CD4+ cells or interferon gamma (IFN-gamma) was sufficient to prevent the elimination of adenovirus-transduced hepatocytes, despite the induction of a measurable CTL response. Mobilization of an effective TH1 response as measured by in vitro proliferation assays was associated with substantial upregulation of MHC class I expression, an effect that was prevented in IFN-gamma-deficient animals. These results suggest that elimination of virus-infected hepatocytes in a primary exposure to recombinant adenovirus requires both induction of antigen-specific CTLs as well as sensitization of the target cell by TH1-mediated activation of MHC class I expression.

B-cell activation by crosslinking of surface IgM or ligation of CD40 involves alternative signal pathways and results in different B-cell phenotypes.

Treatment of small resting B cells with soluble F(ab')2 fragments of anti-IgM, an analogue of T-independent type 2 antigens, induced activation characterized by proliferation and the expression of surface CD5. In contrast, B cells induced to proliferate in response to thymus-dependent inductive signals provided by either fixed activated T-helper 2 cells or soluble CD40 ligand-CD8 (CD40L) recombinant protein displayed elevated levels of CD23 (Fc epsilon II receptor) and no surface CD5. Treatment with anti-IgM and CD40L induced higher levels of proliferation and generated a single population of B cells coexpressing minimal amounts of CD5 and only a slight elevation of CD23. Anti-IgM- but not CD40L-mediated activation was highly sensitive to inhibition by cyclosporin A and FK520. Sp-cAMPS, an analogue of cAMP, augmented CD40L and suppressed surface IgM-mediated activation. Taken together these results are interpreted to mean that there is a single population of small resting B cells that can respond to either T-independent type 2 (surface IgM)- or T-dependent (CD40)-mediated activation. In response to different intracellular signals these cells are induced to enter alternative differentiation pathways.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Short Peptide Vaccine Induces CD4+ T Helper Cells in Patients with Different Solid Cancers

Previous cancer vaccination trials often aimed to activate CD8(+) cytotoxic T-cell (CTL) responses with short (8-10mer) peptides and targeted CD4(+) helper T cells (TH) with HLA class II-binding longer peptides (12-16 mer) that were derived from tumor antigens. Accordingly, a study of immunomonitoring focused on the detection of CTL responses to the short, and TH responses to the long, peptides. The possible induction of concurrent TH responses to short peptides was widely neglected. In a recent phase I vaccination trial, 53 patients with different solid cancers were vaccinated with EMD640744, a cocktail of five survivin-derived short (9- or 10-mer) peptides in Montanide ISA 51VG. We monitored 49 patients and found strong CD8(+) T-cell responses in 63% of the patients. In addition, we unexpectedly found CD4(+) TH cell responses against at least two of the five short peptides in 61% (23/38) of the patients analyzed. The two peptides were recognized by HLA-DP4- and HLA-DR-restricted TH1 cells. Some short peptide-reactive (sp)CD4 T cells showed high functional avidity. Here, we show that a short peptide vaccine is able to activate a specific CD4(+) T-cell repertoire in many patients, facilitating a strong combined CD4(+)/CD8(+) T-cell response. Cancer Immunol Res; 4(1); 18-25. ©2015 AACR.

Early growth response genes 2 and 3 regulate the expression of Bcl6 and differentiation of T follicular helper cells

T follicular helper (Tfh) cells support differentiation of B cells to plasma cells and high affinity antibody production in germinal centers (GC) and Tfh differentiation requires the function of B cell lymphoma 6 (Bcl6). We have now discovered that early growth response gene (Egr) 2 and 3 directly regulate the expression of Bcl6 in Tfh cells which is required for their function in regulation of GC formation. In the absence of Egr2 and 3, the expression of Bcl6 in Tfh cells is defective leading to impaired differentiation of Tfh cells resulting in a failure to form GCs following virus infection and defects in production of anti-viral antibodies. Enforced expression of Bcl6 in Egr2/3 deficient CD4 T cells partially restored Tfh differentiation and GC formation in response to virus infection. Our findings demonstrate a novel function of Egr2/3 which is important for Tfh cell development and Tfh cell mediated B cell immune responses.

Egfr Activating Mutations And Their Association With Response To Platinum-doublet Chemotherapy In Brazilian Non-small Cell Lung Cancer Patients.

The aim of the study was to analyze the frequency of epidermal growth factor receptor (EGFR) mutations in Brazilian non-small cell lung cancer patients and to correlate these mutations with response to benefit of platinum-based chemotherapy in non-small cell lung cancer (NSCLC). Our cohort consisted of prospective patients with NSCLCs who received chemotherapy (platinum derivates plus paclitaxel) at the [UNICAMP], Brazil. EGFR exons 18-21 were analyzed in tumor-derived DNA. Fifty patients were included in the study (25 with adenocarcinoma). EGFR mutations were identified in 6/50 (12 %) NSCLCs and in 6/25 (24 %) adenocarcinomas; representing the frequency of EGFR mutations in a mostly self-reported White (82.0 %) southeastern Brazilian population of NSCLCs. Patients with NSCLCs harboring EGFR exon 19 deletions or the exon 21 L858R mutation were found to have a higher chance of response to platinum-paclitaxel (OR 9.67 [95 % CI 1.03-90.41], p = 0.047). We report the frequency of EGFR activating mutations in a typical southeastern Brazilian population with NSCLC, which are similar to that of other countries with Western European ethnicity. EGFR mutations seem to be predictive of a response to platinum-paclitaxel, and additional studies are needed to confirm or refute this relationship.

Solid Lipid Nanoparticles For Hydrophilic Biotech Drugs: Optimization And Cell Viability Studies (caco-2 & Hepg-2 Cell Lines).

Insulin was used as model protein to developed innovative Solid Lipid Nanoparticles (SLNs) for the delivery of hydrophilic biotech drugs, with potential use in medicinal chemistry. SLNs were prepared by double emulsion with the purpose of promoting stability and enhancing the protein bioavailability. Softisan(®)100 was selected as solid lipid matrix. The surfactants (Tween(®)80, Span(®)80 and Lipoid(®)S75) and insulin were chosen applying a 2(2) factorial design with triplicate of central point, evaluating the influence of dependents variables as polydispersity index (PI), mean particle size (z-AVE), zeta potential (ZP) and encapsulation efficiency (EE) by factorial design using the ANOVA test. Therefore, thermodynamic stability, polymorphism and matrix crystallinity were checked by Differential Scanning Calorimetry (DSC) and Wide Angle X-ray Diffraction (WAXD), whereas the effect of toxicity of SLNs was check in HepG2 and Caco-2 cells. Results showed a mean particle size (z-AVE) width between 294.6 nm and 627.0 nm, a PI in the range of 0.425-0.750, ZP about -3 mV, and the EE between 38.39% and 81.20%. After tempering the bulk lipid (mimicking the end process of production), the lipid showed amorphous characteristics, with a melting point of ca. 30 °C. The toxicity of SLNs was evaluated in two distinct cell lines (HEPG-2 and Caco-2), showing to be dependent on the concentration of particles in HEPG-2 cells, while no toxicity in was reported in Caco-2 cells. SLNs were stable for 24 h in in vitro human serum albumin (HSA) solution. The resulting SLNs fabricated by double emulsion may provide a promising approach for administration of protein therapeutics and antigens.

Autologous Platelet Gel: Five Cases Illustrating Use On Sickle Cell Disease Ulcers.

Leg ulcers represent a particularly disabling complication in patients with sickle cell disease (SCD). Platelet gel (PG) is a novel therapeutic strategy used for accelerating wound healing of a wide range of tissues through the continuous release of platelet growth factors. Here, we describe the use of PG preparation according to Anitua's PRGF (preparations rich in growth factors) protocol for treating chronic nonhealing ulcers in patients with SCD. A positive response occurred in 3 patients with an area reduction of 85.7% to 100%, which occurred within 7 to 10 weeks, and a 35.2% and 20.5% of area reduction in 2 other patients, who however, had large ulcers. After calcium chloride addition, the platelet-rich plasmas demonstrated enhanced platelet-derived growth factors-BB (P < .001), transforming growth factor-β1 (P = .015), vascular endothelial growth factors (P = .03), and hepatocyte growth factors (nonsignificant) secretion. Furthermore, calcium chloride addition induced a significant decrease in platelet number (P = .0134) and there was no leukocyte detection in the PG product. These results demonstrate that PG treatment might impact the healing of leg ulcers in sickle cell disease, especially in patients with small ulcers.

Impaired Compensatory Beta-cell Function And Growth In Response To High-fat Diet In Ldl Receptor Knockout Mice.

In this study, we investigated the effect of low density lipoprotein receptor (LDLr) deficiency on gap junctional connexin 36 (Cx36) islet content and on the functional and growth response of pancreatic beta-cells in C57BL/6 mice fed a high-fat (HF) diet. After 60 days on regular or HF diet, the metabolic state and morphometric islet parameters of wild-type (WT) and LDLr-/- mice were assessed. HF diet-fed WT animals became obese and hypercholesterolaemic as well as hyperglycaemic, hyperinsulinaemic, glucose intolerant and insulin resistant, characterizing them as prediabetic. Also they showed a significant decrease in beta-cell secretory response to glucose. Overall, LDLr-/- mice displayed greater susceptibility to HF diet as judged by their marked cholesterolaemia, intolerance to glucose and pronounced decrease in glucose-stimulated insulin secretion. HF diet induced similarly in WT and LDLr-/- mice, a significant decrease in Cx36 beta-cell content as revealed by immunoblotting. Prediabetic WT mice displayed marked increase in beta-cell mass mainly due to beta-cell hypertrophy/replication. Nevertheless, HF diet-fed LDLr-/- mice showed no significant changes in beta-cell mass, but lower islet-duct association (neogenesis) and higher beta-cell apoptosis index were seen as compared to controls. The higher metabolic susceptibility to HF diet of LDLr-/- mice may be explained by a deficiency in insulin secretory response to glucose associated with lack of compensatory beta-cell expansion.