Reproductive parameters of dairy goats submitted to estrus synchronization with prostaglandin F2α associated or not to hCG at estrous onset

O objetivo deste estudo foi avaliar a eficiência do uso de duas doses de PGF associadas ou não à administração de hCG no início do estro sobre os parâmetros reprodutivos de cabras leiteiras. Um total de 29 cabras receberam duas doses de 30 µg d-cloprostenol pela via latero-vulvar com 10 dias de intervalo (Dia 1 e Dia 10). As cabras foram alocadas para receberem o hCG (250 IU) ou salina i.m. no momento em que o estro foi detectado. Depois da realização da segunda dose de PGF, o estro foi monitorado e exames ultrassonográficos foram realizados duas vezes ao dia. Todas as fêmeas foram inseminadas 16 h após o inicio do estro. Amostras de sangue foram coletadas diariamente para determinação das concentrações plasmáticas de progesterona. O uso do hCG no momento do início do estro não afetou os parâmetros estudados e, portanto, os dados serão apresentados agrupados. A taxa de manifestação de estro foi similar (P > 0,05) na primeira (75,9% - 22/29) ou na segunda dose de PGF (79,3% - 23/29). O intervalo entre a administração de PGF e o início do estro foi maior (P < 0,05) no Dia 1 (75,8±53,9 h) que no Dia 10 (47,7±10,1 h). Duração do estro também diferiu (P < 0,05) 35,4±15,9 (Dia 1) vs 26,8±15, 0 h (Dia 10). A taxa de ovulação foi 79,3% (23/29) após a segunda dose PGF. Não foi encontrada diferença (P>0,05) entre os grupos experimentais quanto aos parâmetros reprodutivos: intervalo entre a aplicação da segunda dose e a ovulação (86,6±11,4h), intervalo do estro a ocorrência da ovulação (39,9±12,3h), diâmetro do maior folículo (7,2±1,4) e número de ovulações (1,8±0,6). No Dia 1, 52,4% (11/21) apresentavam concentrações de progesterona < 1 ng/mL. No Dia 10, 100% dos animais apresentavam concentrações >1ng/mL. O presente estudo permite concluir que o estro pode ser eficientemente sincronizado em cabras leiteiras com duas doses de PGF intervaladas em 10 dias. Novas pesquisas devem se realizadas para avaliar diferentes doses e momentos de utilização do hCG.

Avanços na criopreservação do sêmen ovino I: diluidores e crioprotetores

The effectiveness of using frozen sheep semen in artificial insemination programs requires the development of extenders and freezing protocols that will increase pregnancy rate of inseminated females. This work aimed to survey the main extenders, additives and external and internal cryoprotectants that have been employed to improve the maintenance levels of sperm parameters after the freezing-thawing process. Better rates of post-thawing sheep sperm viability may be obtained with changes in the freezing extender composition, whether by the adjustment of its components or by introducing additives that inhibit the occurrence of sperm changes during the cryopreservation process. Thus, the possible changes proposed must take into consideration the intrinsic characteristics of ram semen and the individual variability among animals. It is important to emphasize that the sperm cryopreservation effectiveness requires that all process steps are conducted in an integrated manner, to maximize the fertility rate of frozen ram semen.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Embriões bovinos produzidos in vitro com espermatozoides sexados por citometria de fluxo: avaliação do desenvolvimento embrionário e da expressão de genes candidatos ao reconhecimento da gestação

Pós-graduação em Genética e Melhoramento Animal - FCAV

Resposta luteal à PGF2α (Dinoprost Trometamina) durante as fases de luteogênese e manutenção do corpo lúteo em éguas

Pós-graduação em Medicina Veterinária - FMVZ

Efeito da adição da L-carnitina e acetil-L-carnitina sobre a viabilidade espermática na refrigeração do sêmen equino

Pós-graduação em Biotecnologia Animal - FMVZ

Efeito da administração da sulpirida no desenvolvimento folicular em éguas

Pós-graduação em Biotecnologia Animal - FMVZ

Transporte placentário via cavéola na placenta de bovinos clonados e transgênicos

Pós-graduação em Ciência e Tecnologia Animal - FEIS

Técnicas associadas à biotecnologia da reprodução para minimizar os efeitos do estresse térmico e aumentar a fertilidade em vacas leiteiras de alta produção

The dairy sector has undergone considerable economic losses due to low fertility rates due to adverse effects of heat stress on reproduction of cows. Genetic selection for increased production, coupled with the expanding dairy to tropical areas of the planet, and global warming has further aggravated the problem of heat stress. The effects of heat stress are multifactorial and act directly or indirectly at various levels of reproductive tissues, resulting in low fertility of cows, which in practice, results in reduced reproductive efficiency in the property, reducing the producers’ profit. Some strategies related to breeding biotechnology such as fixed-time artificial insemination, embryo transfer and use of BST, can minimize these effects and improve the reproductive efficiency of the herd

Principais marcadores utilizados na avaliação da qualidade do sêmen de animais domésticos

Methods of semen cryopreservation allow changes in spermatic cells, such as damage in plasma and acrossomal membrane and modifications in mitochondrial function due to a disorder in the lipidic bilayer. For effective oocyte fertilization, spermatozoa require functional competent membranes, and intact organelles, acrosome and DNA. However, most laboratory methods used to evaluate semen quality are not highly correlated with fertilizing capacity. The discovery of a variety of fluorochromes and compounds conjugated to fluorescent probes has enabled an accurate assessment of the viability, integrity and function of spermatozoa. Among the most used probes that label the various compartments of the sperm cell there are the membrane impermeable fluorescent dyes to test the membrane integrity, as well as acylated dyes that pass the intact membrane. For the acrossomal integrity the most commonly used method is lectins labeled by a fluorescent probe. The acrosome reaction and spermatic capacitation is detected by the evaluation of membrane architecture and disorder of lipids in plasma membrane. Mitochondrial function can be determined using markers for their aerobic activity. The DNA status of spermatozoa has been determined using the metachromatic properties of Acridine Orange, and the DNA fragmentation can also be assessed by TUNEL assay. Finally, DNA condensation is analyzed using a single cell DNA gel electrophoresis assay that indicates DNA compactation. This monograph aims to compile the various tests used to detect damaged spermatozoa under cryopreservation methods, searching for improve the predictive value of semen analysis with the intention of a successful conception

Fatores que podem influenciar o sexo da cria em bovinos

To assess the possibility of shifting the sex ratio at birth, since this can contribute to enhancing the genetic gain and producity in cattle, this work is aimed at raising the factors that may influence sex determination of creates. This study is based on research conducted in the area of reproduction and production of beef and dairy cattle, some quotes in humans, mouse, dogs and a study in pigs. This was due to back of data and studies in the bovine species. It was noted that stress during pregnancy, intake of vitamin C or others substances and the time of artificial insemination are the factors that may influence the determination of the type of product. Human studies, concluded that woman more stressed are more likely to produce female children of the quietest. Furthermore, sows that received ascorbic a ad orally for seven days and were inseminated during this period, produce more female then those who did not receive the vitamin. These studies may suggest that cows can also suffer influence of stress and food for the determination of sex of calf. There are also studies suggesting that cows inseminated at the earliest time of ovulation ted to produce more male calves than those inseminated a few hours before that time. Some scholars considers the hypothesis... (Complete abstract click electronic access below)

Indução de parto em bovinos: Princípios e aplicações

Currently, Brazil has one of the largest cattle herds worldwide. In order to keep that milk and meat were introduced reproductive biotechnologies such as artificial insemination, embryo transfer and in vitro fertilization. In certain situations the technique may have undesired effect, for example, the production of calve calves due to the very large increase in the gestation period when performed in vitro fertilization. To avoid this problem we perform the induction of labor in order to prevent the product is longer the womb. This induction can also be made in case of diseases that compromise the life of the mother, twin pregnancy an abnormal size calf. The administration of short acting steroids, prostaglandins, association of short acting steroids and prostaglandins and association of short acting steroids, prostaglandins and long-acting corticosteroids are some of the possibilities of induction

Fatores que interferem nas taxas de recuperação embrionária em éguas

The success in implementing an embryo transfer program derives from many factors. The embryo recovery rate is one of the most important factors, and allows the transfer to the recipient mare. This rate comes from a group of elements such as donor´s characteristics, collection date, reproductive management, semen quality, technician skill. Mainly because of the great importance of this direct interference on the results of an embryo recovery program, this study aimed to review the factors involved in embryo recovery rates in donor mares during an embryo transfer, suggesting some ways of improving these results

Resposta endometrial de jumentas (Equus asinus) da raça Pêga ao sêmen fresco, extendido e congelado de jumento

Pós-graduação em Cirurgia Veterinária - FCAV

Toxicologia reprodutiva de ratos adultos expostos ao 2,3,7,8-Tetraclorodibenzo-P-Dioxina (TCDD) in útero

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)