What is what?: A simple time-domain test of long-memory vs. structural breaks

This paper proposes a new time-domain test of a process being I(d), 0 < d = 1, under the null, against the alternative of being I(0) with deterministic components subject to structural breaks at known or unknown dates, with the goal of disentangling the existing identification issue between long-memory and structural breaks. Denoting by AB(t) the different types of structural breaks in the deterministic components of a time series considered by Perron (1989), the test statistic proposed here is based on the t-ratio (or the infimum of a sequence of t-ratios) of the estimated coefficient on yt-1 in an OLS regression of ?dyt on a simple transformation of the above-mentioned deterministic components and yt-1, possibly augmented by a suitable number of lags of ?dyt to account for serial correlation in the error terms. The case where d = 1 coincides with the Perron (1989) or the Zivot and Andrews (1992) approaches if the break date is known or unknown, respectively. The statistic is labelled as the SB-FDF (Structural Break-Fractional Dickey- Fuller) test, since it is based on the same principles as the well-known Dickey-Fuller unit root test. Both its asymptotic behavior and finite sample properties are analyzed, and two empirical applications are provided.

Identification et qualification des compétences d'entreprise

STRUCTURE DU DOCUMENT ET PRINCIPALES CONTRIBUTIONS CHAPITRE 1 INTRODUCTION ET MÉTHODOLOGIE Le chapitre 1 présente un aperçu de la recherche, le contexte, les objectifs, la méthodologie, la démarche. CHAPITRE 2 : ÉTAT DE LA QUESTION Le chapitre 2 présente un état de la question des principaux concepts : les compétences, la gestion des compétences, les systèmes de gestion des compétences. La question de la gestion des compétences en sciences de gestion, et son lien avec la stratégie de l'entreprise a beaucoup occupé les chercheurs et les praticiens. On peut distinguer deux tendances principales : les recherches provenant du champ disciplinaire de la stratégie d'entreprise, regroupées par commodité sous l'étiquette «approche stratégique », et les recherches issues du domaine de la gestion des ressources humaines, qu'on appellera GRH. Au-delà du vocabulaire souvent commun (ressources, compétences), de la vision partagée qu'il est nécessaire de voir l'entreprise « de l'intérieur » et non plus uniquement dans son environnement, les deux approches ont des problématiques très similaires, comme le lien avec la performance ou les changements organisationnels induits par une démarche compétence. Pourtant, les divergences subsistent. L'approche stratégique procède d'un niveau « macro »pour identifier des « compétences-clés », et peine souvent à opérationnaliser ce concept. Les démarches GRH ont un souci analytique de décomposition de la compétence et de la ressource qui risque de noyer la démarche dans le détail. En outre, alors que le vocabulaire est similaire, les définitions divergent. Concilier ces divergences, afin de conserver les avantages de l'une et de l'autre de ces théories, à savoir le lien avec la stratégie pour l'une et le souci d'opérationnaliser les concepts pour l'autre est peut être plus aisé à l'heure ou les nouvelles conditions auxquelles sont soumises les entreprises qui oeuvrent dans l' »économie de la connaissance ». Les technologies qui deviennent accessibles plus facilement font qu'en dernière instance, ce sont bien les collaborateurs de l'entreprise qui sont le support de la compétence. L'objectif de cet état de la question n'est pas de procéder à un recensement exhaustif des manières de traiter de la compétence en sciences de gestion. Il est plutôt de mettre en évidence ce que les deux approches peuvent amener, chacun à leur manière, à notre problème, l'identification des compétences d'entreprise en lien avec la stratégie. Ces éléments nous serviront de matériau pour construire notre propre modèle d'identification des compétences. C'est sans doute la première fois que ces deux modèles sont confrontés du point de vue de la stratégie de l'entreprise. CHAPITRE 3 : LE MODÈLE CONCEPTUEL Le chapitre 3 présente le modèle conceptuel d'identification des compétences d'entreprise. Après une discussion sur la notion de modèle en sciences de gestion, il présente l'intérêt d'une modélisation, et la démarche de modélisation. Celle-ci se décompose en 3 étapes concentriques successives : un modèle informel, un modèle semi-formel qui prendra la forme d'une ontologie, et quelques éléments d'un modèle formel. Une présentation des ontologies et de l'utilité de cette technique précèdera la construction du modèle à proprement parler. Cette construction se fera à partir des fonctionnalités d'un système de gestion des compétences défini comme utile à l'entreprise, c'est à dire répondant aux objectifs. Dans cette partie, nous construirons notre modèle conceptuel d'identification et de qualification des compétences d'entreprises. Nous commencerons par préciser la notion de modèle. Un modèle consiste en une schématisation, -qui typifie certaines caractéristiques du réel, pour en faire ressortir certains traits dominants, les mettre en valeur et permettre ainsi d'anticiper certains développements de la réalité. Nous sélectionnerons et préciserons ensuite les entités nécessaires à la composition du modèle. Nous définirons ainsi le concept de compétences et les concepts qui lui sont liés. Dans une troisième partie, nous montrerons en quoi la technique des ontologies peut se révéler utile pour notre problématique. CHAPITRE 4 : LE MODÈLE DE RAISONNEMENT Le chapitre 4 présente le modèle de raisonnement, quelques fonctionnalités du prototype, quelques éléments de l'algorithme, une esquisse de l'architecture, des requêtes possibles, vues à travers une technique inspirée des use-cases. La partie précédente aura permis de sélectionner les entités nécessaires à un modèle d'identification et de qualification des compétences. Dans cette partie, nous allons développer le modèle de raisonnement. L'objectif de notre travail est d'identifier concrètement les compétences de l'entreprise, et de les qualifier, afin de servir d'aide à la décision. Dans cette optique, le modèle de raisonnement décrira les opérations effectuées sur les entités identifiées précédemment. Après avoir défini le modèle de raisonnement et son fonctionnement, nous présenterons les quatre cas d'utilisation qui nous servirons d'exemples d'utilisation. Il s'agit des cas de dirigeant d'entreprise, responsable des ressources humaines, chef de projet, et collaborateur de l'entreprise. Ces cas d'utilisation nous permettrons d'opérationnaliser les concepts décrits dans le modèle conceptuel à travers un système d'indicateurs, d'effectuer des opérations sur ces concepts. ANNEXE : UNE ÉTUDE DE CAS Enfin, en annexe de ce document, nous décrirons une étude de cas. Il s'agit d'une intervention menée en entreprise, qui a repris, et ainsi testé, une bonne partie des éléments décrits dans ce travail. Cette intervention a débouché sur la mise en place d'une gestion des compétences qui se concrétise notamment par un «tableau de bord des compétences ». CHAPITRE 5 : CONCLUSIONS ET PERSPECTIVES Le chapitre 5 présente les conclusions, et quelques perspectives. Il présente les principaux apports, les limites, un retour sur certaines questions méthodologiques. PRINCIPALES CONTRIBUTIONS L'objectif de cette thèse est de proposer un modèle qui permette d'identifier et de qualifier les compétences d'entreprise. On peut dégager un certain nombre de contributions 1. Nous proposons un modèle d'identification et de qualification des compétences en cohérence avec les préoccupations des entreprises, notamment par le lien avec la stratégie, qui permet l'adaptabilité et la flexibilité. 2. Nous proposons une méthode de qualification des compétences qui permet de distinguer les compétences d'entreprise selon différents points de vue 3. Nous proposons des fonctionnalités et une architecture rendant possible la réalisation d'un outil de gestion des compétences.

Identification of psychological dysfunctions and eating disorders in obese women seeking weight loss: cross-sectional study.

Objective. The aim of this study is to analyse associations between eating behaviour and psychological dysfunctions in treatment-seeking obese patients and identify parameters for the development of diagnostic tools with regard to eating and psychological disorders. Design and Methods. Cross-sectional data were analysed from 138 obese women. Bulimic Investigatory Test of Edinburgh and Eating Disorder Inventory-2 assessed eating behaviours. Beck Depression Inventory II, Spielberger State-Trait Anxiety Inventory, form Y, Rathus Assertiveness Schedule, and Marks and Mathews Fear Questionnaire assessed psychological profile. Results. 61% of patients showed moderate or major depressive symptoms and 77% showed symptoms of anxiety. Half of the participants presented with a low degree of assertiveness. No correlation was found between psychological profile and age or anthropometric measurements. The prevalence and severity of depression, anxiety, and assertiveness increased with the degree of eating disorders. The feeling of ineffectiveness explained a large degree of score variance. It explained 30 to 50% of the variability of assertiveness, phobias, anxiety, and depression. Conclusion. Psychological dysfunctions had a high prevalence and their severity is correlated with degree of eating disorders. The feeling of ineffectiveness constitutes the major predictor of the psychological profile and could open new ways to develop screening tools.

Combinations of prognostic tools for identification of high-risk normotensive patients with acute symptomatic pulmonary embolism.

Background: In haemodynamically stable patients with acute symptomatic pulmonary embolism (PE), studies have not evaluated the usefulness of combining the measurement of cardiac troponin, transthoracic echocardiogram (TTE), and lower extremity complete compression ultrasound (CCUS) testing for predicting the risk of PE-related death. Methods: The study assessed the ability of three diagnostic tests (cardiac troponin I (cTnI), echocardiogram, and CCUS) to prognosticate the primary outcome of PE-related mortality during 30 days of follow-up after a diagnosis of PE by objective testing. Results: Of 591 normotensive patients diagnosed with PE, the primary outcome occurred in 37 patients (6.3%; 95% CI 4.3% to 8.2%). Patients with right ventricular dysfunction (RVD) by TTE and concomitant deep vein thrombosis (DVT) by CCUS had a PE-related mortality of 19.6%, compared with 17.1% of patients with elevated cTnI and concomitant DVT and 15.2% of patients with elevated cTnI and RVD. The use of any two-test strategy had a higher specificity and positive predictive value compared with the use of any test by itself. A combined three-test strategy did not further improve prognostication. For a subgroup analysis of high-risk patients, according to the pulmonary embolism severity index (classes IV and V), positive predictive values of the two-test strategies for PE-related mortality were 25.0%, 24.4% and 20.7%, respectively. Conclusions: In haemodynamically stable patients with acute symptomatic PE, a combination of echocardiography (or troponin testing) and CCUS improved prognostication compared with the use of any test by itself for the identification of those at high risk of PE-related death.

Breast cancer and melanoma cell line identification by FTIR imaging after formalin-fixation and paraffin-embedding.

Over the past few decades, Fourier transform infrared (FTIR) spectroscopy coupled to microscopy has been recognized as an emerging and potentially powerful tool in cancer research and diagnosis. For this purpose, histological analyses performed by pathologists are mostly carried out on biopsied tissue that undergoes the formalin-fixation and paraffin-embedding (FFPE) procedure. This processing method ensures an optimal and permanent preservation of the samples, making FFPE-archived tissue an extremely valuable source for retrospective studies. Nevertheless, as highlighted by previous studies, this fixation procedure significantly changes the principal constituents of cells, resulting in important effects on their infrared (IR) spectrum. Despite the chemical and spectral influence of FFPE processing, some studies demonstrate that FTIR imaging allows precise identification of the different cell types present in biopsied tissue, indicating that the FFPE process preserves spectral differences between distinct cell types. In this study, we investigated whether this is also the case for closely related cell lines. We analyzed spectra from 8 cancerous epithelial cell lines: 4 breast cancer cell lines and 4 melanoma cell lines. For each cell line, we harvested cells at subconfluence and divided them into two sets. We first tested the "original" capability of FTIR imaging to identify these closely related cell lines on cells just dried on BaF2 slides. We then repeated the test after submitting the cells to the FFPE procedure. Our results show that the IR spectra of FFPE processed cancerous cell lines undergo small but significant changes due to the treatment. The spectral modifications were interpreted as a potential decrease in the phospholipid content and protein denaturation, in line with the scientific literature on the topic. Nevertheless, unsupervised analyses showed that spectral proximities and distances between closely related cell lines were mostly, but not entirely, conserved after FFPE processing. Finally, PLS-DA statistical analyses highlighted that closely related cell lines are still successfully identified and efficiently distinguished by FTIR spectroscopy after FFPE treatment. This last result paves the way towards identification and characterization of cellular subtypes on FFPE tissue sections by FTIR imaging, indicating that this analysis technique could become a potential useful tool in cancer research.

Molecular Identification of Trichoderma spp. in Garlic and Onion Fields and In Vitro Antagonism Trials on Sclerotium cepivorum

ABSTRACT Trichoderma species are non-pathogenic microorganisms that protect against fungal diseases and contribute to increased crop yields. However, not all Trichoderma species have the same effects on crop or a pathogen, whereby the characterization and identification of strains at the species level is the first step in the use of a microorganism. The aim of this study was the identification – at species level – of five strains of Trichoderma isolated from soil samples obtained from garlic and onion fields located in Costa Rica, through the analysis of the ITS1, 5.8S, and ITS2 ribosomal RNA regions; as well as the determination of their individual antagonistic ability over S. cepivorum Berkeley. In order to distinguish the strains, the amplified products were analyzed using MEGA v6.0 software, calculating the genetic distances through the Tamura-Nei model and building the phylogenetic tree using the Maximum Likelihood method. We established that the evaluated strains belonged to the species T. harzianum and T. asperellum; however it was not possible to identify one of the analyzed strains based on the species criterion. To evaluate their antagonistic ability, the dual culture technique, Bell’s scale, and the percentage inhibition of radial growth (PIRG) were used, evidencing that one of the T. asperellum isolates presented the best yields under standard, solid fermentation conditions.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Application of the Mutual Information Minimization to speaker recognition / identification improvement

In this paper we propose the inversion of nonlinear distortions in order to improve the recognition rates of a speaker recognizer system. We study the effect of saturations on the test signals, trying to take into account real situations where the training material has been recorded in a controlled situation but the testing signals present some mismatch with the input signal level (saturations). The experimental results for speaker recognition shows that a combination of several strategies can improve the recognition rates with saturated test sentences from 80% to 89.39%, while the results with clean speech (without saturation) is 87.76% for one microphone, and for speaker identification can reduce the minimum detection cost function with saturated test sentences from 6.42% to 4.15%, while the results with clean speech (without saturation) is 5.74% for one microphone and 7.02% for the other one.

On Modelling, System Identification and Control of Servo-Systems with a Flexible Load

The present study was done with two different servo-systems. In the first system, a servo-hydraulic system was identified and then controlled by a fuzzy gainscheduling controller. The second servo-system, an electro-magnetic linear motor in suppressing the mechanical vibration and position tracking of a reference model are studied by using a neural network and an adaptive backstepping controller respectively. Followings are some descriptions of research methods. Electro Hydraulic Servo Systems (EHSS) are commonly used in industry. These kinds of systems are nonlinearin nature and their dynamic equations have several unknown parameters.System identification is a prerequisite to analysis of a dynamic system. One of the most promising novel evolutionary algorithms is the Differential Evolution (DE) for solving global optimization problems. In the study, the DE algorithm is proposed for handling nonlinear constraint functionswith boundary limits of variables to find the best parameters of a servo-hydraulic system with flexible load. The DE guarantees fast speed convergence and accurate solutions regardless the initial conditions of parameters. The control of hydraulic servo-systems has been the focus ofintense research over the past decades. These kinds of systems are nonlinear in nature and generally difficult to control. Since changing system parameters using the same gains will cause overshoot or even loss of system stability. The highly non-linear behaviour of these devices makes them ideal subjects for applying different types of sophisticated controllers. The study is concerned with a second order model reference to positioning control of a flexible load servo-hydraulic system using fuzzy gainscheduling. In the present research, to compensate the lack of dampingin a hydraulic system, an acceleration feedback was used. To compare the results, a pcontroller with feed-forward acceleration and different gains in extension and retraction is used. The design procedure for the controller and experimental results are discussed. The results suggest that using the fuzzy gain-scheduling controller decrease the error of position reference tracking. The second part of research was done on a PermanentMagnet Linear Synchronous Motor (PMLSM). In this study, a recurrent neural network compensator for suppressing mechanical vibration in PMLSM with a flexible load is studied. The linear motor is controlled by a conventional PI velocity controller, and the vibration of the flexible mechanism is suppressed by using a hybrid recurrent neural network. The differential evolution strategy and Kalman filter method are used to avoid the local minimum problem, and estimate the states of system respectively. The proposed control method is firstly designed by using non-linear simulation model built in Matlab Simulink and then implemented in practical test rig. The proposed method works satisfactorily and suppresses the vibration successfully. In the last part of research, a nonlinear load control method is developed and implemented for a PMLSM with a flexible load. The purpose of the controller is to track a flexible load to the desired position reference as fast as possible and without awkward oscillation. The control method is based on an adaptive backstepping algorithm whose stability is ensured by the Lyapunov stability theorem. The states of the system needed in the controller are estimated by using the Kalman filter. The proposed controller is implemented and tested in a linear motor test drive and responses are presented.

Short communication.Wood identification based on their common name and their transversal surface anatomy. Application to the batch from the expedition of Ruiz and Pavon

Aim of study: To identify species of wood samples based on common names and anatomical analyses of their transversal surfaces (without microscopic preparations). Area of study: Spain and South America Material and methods: The test was carried out on a batch of 15 lumber samples deposited in the Royal Botanical Garden in Madrid, from the expedition by Ruiz and Pavon (1777-1811). The first stage of the methodology is to search and to make a critical analysis of the databases which list common nomenclature along with scientific nomenclature. A geographic filter was then applied to the information resulting from the samples with a more restricted distribution. Finally an anatomical verification was carried out with a pocket microscope with a magnification of x40, equipped with a 50 micrometers resolution scale. Main results: The identification of the wood based exclusively on the common name is not useful due to the high number of alternative possibilities (14 for “naranjo”, 10 for “ébano”, etc.). The common name of one of the samples (“huachapelí mulato”) enabled the geographic origin of the samples to be accurately located to the shipyard area in Guayaquil (Ecuador). Given that Ruiz y Pavon did not travel to Ecuador, the specimens must have been obtained by Tafalla. It was possible to determine correctly 67% of the lumber samples from the batch. In 17% of the cases the methodology did not provide a reliable identification. Research highlights: It was possible to determine correctly 67% of the lumber samples from the batch and their geographic provenance. The identification of the wood based exclusively on the common name is not useful.

Identification-commitment inventory (ICI-Model): confirmatory factor analysis and construct validity

The aim of this study is to confirm the factorial structure of the Identification-Commitment Inventory (ICI) developed within the frame of the Human System Audit (HSA) (Quijano et al. in Revist Psicol Soc Apl 10(2):27-61, 2000; Pap Psicól Revist Col Of Psicó 29:92-106, 2008). Commitment and identification are understood by the HSA at an individual level as part of the quality of human processes and resources in an organization; and therefore as antecedents of important organizational outcomes, such as personnel turnover intentions, organizational citizenship behavior, etc. (Meyer et al. in J Org Behav 27:665-683, 2006). The theoretical integrative model which underlies ICI Quijano et al. (2000) was tested in a sample (N = 625) of workers in a Spanish public hospital. Confirmatory factor analysis through structural equation modeling was performed. Elliptical least square solution was chosen as estimator procedure on account of non-normal distribution of the variables. The results confirm the goodness of fit of an integrative model, which underlies the relation between Commitment and Identification, although each one is operatively different.

Identification of the major fungitoxic component of cinnamon bark oil

The study was done to identify the most active fungitoxic component of cinnamon bark (Cinnamomum zeylanicum) oil that can be used as a marker for standardization of cinnamon extract or oil based natural preservative of stored seeds. Aspergillus flavus and A. ruber were used as test fungi. The hexane extracted crude oil and the hydro-distilled essential oil from cinnamon bark had complete growth inhibition concentration (CGIC) of 300 and 100 µl/l, respectively. Both oils produced three fractions on preparative thin layer silica-gel chromatography plates. The fraction-2 of either oil was the largest and most active, with CGIC of 200 µl/l, but the fungitoxicity was also retained in the other two fractions. The fraction-1 and 3 of the crude oil reduced growth of both the fungal species by 65%, and those of distilled oil by 45% at 200 µl/l. The CGIC of these fractions from both the sources was above 500 µl/l. The gas chromatography and mass spectrometry (GC-MS) of the fraction-2 of the hexane extract revealed that it contained 61% cinnamaldehyde, 29% cinnamic acid, and two minor unidentified compounds in the proportion of 4% and 6%. The GC-MS of the fraction-2 of the distilled oil revealed that it contained 99.1% cinnamaldehyde and 0.9% of an unidentified compound. The CGIC of synthetic cinnamaldehyde was 300 µl/l and that of cinnamic acid above 500 µl/l. The 1:1 mixture of cinnamaldehyde and cinnamic acid had CGIC of 500 µl/l. The data revealed that cinnamaldehyde was the major fungitoxic component of hexane extract and the distilled essential oil of cinnamon bark, while other components have additive or synergistic effects on total fungitoxicity. It is suggested that the natural seed preservative based on cinnamon oil can be standardized against cinnamaldehyde.

Broadband excitation in the system identification of active magnetic bearing rotor systems

One of the targets of the climate and energy package of the European Union is to increase the energy efficiency in order to achieve a 20 percent reduction in primary energy use compared with the projected level by 2020. The energy efficiency can be improved for example by increasing the rotational speed of large electrical drives, because this enables the elimination of gearboxes leading to a compact design with lower losses. The rotational speeds of traditional bearings, such as roller bearings, are limited by mechanical friction. Active magnetic bearings (AMBs), on the other hand, allow very high rotational speeds. Consequently, their use in large medium- and high-speed machines has rapidly increased. An active magnetic bearing rotor system is an inherently unstable, nonlinear multiple-input, multiple-output system. Model-based controller design of AMBs requires an accurate system model. Finite element modeling (FEM) together with the experimental modal analysis provides a very accurate model for the rotor, and a linearized model of the magneticactuators has proven to work well in normal conditions. However, the overall system may suffer from unmodeled dynamics, such as dynamics of foundation or shrink fits. This dynamics can be modeled by system identification. System identification can also be used for on-line diagnostics. In this study, broadband excitation signals are adopted to the identification of an active magnetic bearing rotor system. The broadband excitation enables faster frequency response function measurements when compared with the widely used stepped sine and swept sine excitations. Different broadband excitations are reviewed, and the random phase multisine excitation is chosen for further study. The measurement times using the multisine excitation and the stepped sine excitation are compared. An excitation signal design with an analysis of the harmonics produced by the nonlinear system is presented. The suitability of different frequency response function estimators for an AMB rotor system are also compared. Additionally, analytical modeling of an AMB rotor system, obtaining a parametric model from the nonparametric frequency response functions, and model updating are discussed in brief, as they are key elements in the modeling for a control design. Theoretical methods are tested with a laboratory test rig. The results conclude that an appropriately designed random phase multisine excitation is suitable for the identification of AMB rotor systems.

Test for alternative indicator of soybean sowing depth

Among studies focused on increasing soybean grain yield, the ones related to sowing process are the most significant. Considering that soybean has an epigeal emergence, it becomes difficult to hint at the length covered by hypocotyl up to soil surface, or the actual planting depth. This study aimed to find an indicator that allows the identification of an ideal soybean planting depth. For this purpose, two complementary assays has been carried out in a greenhouse. The first aimed to identify structures that could be indicators of seed planting depth, on a medium-textured soil from Campos Gerais region, in the state of Paraná, Brazil. Spring NK 8350 cultivar seeds were sown at five theoretical depths (1, 2, 3, 4 and 5 cm). As seedlings emerged, the “differentiation zone” and the “root curve” depths were measured. The second assay was the validation of the suggested indicators in assay 1 from two soils, one medium-textured and one clay-textured. For this assay, it was used BRS 232. Both the methodologies showed high correlation with the theoretical planting depth. Although their correlation coefficient values were close, the differentiation zone appeared to be the most efficient reference with less planting depth overestimation.

The use of infrared thermography in the identification of pododermatitis in broilers

ABSTRACT International trade in broiler’ feet, mainly to Asian markets, has demanded better quality control. The objective of this research was to study the suitability of using chicken footpad surface temperature to determine early lesions of pododermatitis. The project was conducted in two houses A1 and A2) in a commercial farm during one production flock. A1 had reused litter of wood shavings and rice hulls, and A2 had a new litter of sawdust. Both houses had positive pressure ventilation. The inner area of the poultry was virtually divided into three quadrants. The footpads were checked for the feet quality, and a degree of pododermatitis was awarded. Thermal images were made to test the surface temperature of the foot and identify inflammation in a total of 30 birds per house, at ages 5, 19, 29, 28 and 40 days of grow-out. Conditions of the rearing environment as well as the surface temperature of the litter, litter moisture, and degree of compression, were recorded. The environment within the houses did not differ. The surface temperatures of the footpad did not differ between the groups. The minimum footpad surface temperatures within the scores were similar, except for the score 3, which did not occur in A1. There was a prevalence of severe injury in the house with a new litter.