Vaccination with syngeneic, lymphoma-derived immunoglobulin idiotype combined with granulocyte/macrophage colony-stimulating factor primes mice for a protective T-cell response.

The idiotype of the Ig expressed by a B-cell malignancy (Id) can serve as a unique tumor-specific antigen and as a model for cancer vaccine development. In murine models of Id vaccination, formulation of syngeneic Id with carrier proteins or adjuvants induces an anti-idiotypic antibody response. However, inducing a potent cell-mediated response to this weak antigen instead would be highly desirable. In the 38C13 lymphoma model, we observed that low doses of free granulocyte/macrophage colony-stimulating factor (GM-CSF) 10,000 units i.p. or locally s.c. daily for 4 days significantly enhanced protective antitumor immunity induced by s.c. Id-keyhole limpet hemocyanin (KLH) immunization. This effect was critically dependent upon effector CD4+ and CD8+ T cells and was not associated with any increased anti-idiotypic antibody production. Lymphocytes from spleens and draining lymph nodes of mice primed with Id-KLH plus GM-CSF, but not with Id-KLH alone, demonstrated significant proliferation to Id in vitro without any biased production of interferon gamma or interleukin 4 protein or mRNA. As a further demonstration of potency, 50% of mice immunized with Id-KLH plus GM-CSF on the same day as challenge with a large s.c. tumor inoculum remained tumor-free at day 80, compared with 17% for Id-KLH alone, when immunization was combined with cyclophosphamide. Taken together, these results demonstrate that GM-CSF can significantly enhance the immunogenicity of a defined self-antigen and that this effect is mediated exclusively by activating the T-cell arm of the immune response.

Subcutaneous vaccination with irradiated, cytokine-producing tumor cells stimulates CD8+ cell-mediated immunity against tumors located in the "immunologically privileged" central nervous system.

Vaccination with cytokine-producing tumor cells generates potent immune responses against tumors outside the central nervous system (CNS). The CNS, however, is a barrier to allograft and xenograft rejection, and established tumors within the CNS have failed to respond to other forms of systemic immunotherapy. To determine what barriers the "immunologically privileged" CNS would pose to cytokine-assisted tumor vaccines and what cytokines would be most efficacious against tumors within the CNS, we irradiated B16 murine melanoma cells producing murine interleukin 2 (IL-2), IL-3, IL-4, IL-6, gamma-interferon, or granulocyte-macrophage colony stimulating factor (GM-CSF) and used these cells as subcutaneous vaccines against tumors within the brain. Under conditions where untransfected B16 cells had no effect, cells producing IL-3, IL-6, or GM-CSF increased the survival of mice challenged with viable B16 cells in the brain. Vaccination with B16 cells producing IL-4 or gamma-interferon had no effect, and vaccination with B16 cells producing IL-2 decreased survival time. GM-CSF-producing vaccines were also able to increase survival in mice with pre-established tumors. The response elicited by GM-CSF-producing vaccines was found to be specific to tumor type and to be abrogated by depletion of CD8+ cells. Unlike the immunity generated against subcutaneous tumors by GM-CSF, however, the effector responses generated against tumors in the CNS were not dependent on CD4+ cells. These data suggest that cytokine-producing tumor cells are very potent stimulators of immunity against tumors within the CNS, but effector responses in the CNS may be different from those obtained against subcutaneous tumors.

Inhibition of cytokines and JAK-STAT activation by distinct signaling pathways.

An important component of cytokine regulation of cell growth and differentiation is rapid transcriptional activation of genes by the JAK-STAT (signal transducer and activator of transcription) signaling pathway. Ligation of cytokine receptors results in tyrosine phosphorylation and activation of receptor-associated Jak protein tyrosine kinases and cytoplasmic STAT transcription factors, which then translocate to the nucleus. We describe the interruption of cytokine triggered JAK-STAT signals by cAMP, the calcium ionophore ionomycin, and granulocyte/macrophage colony-stimulating factor. Jak1 kinase activity, interleukin 6-induced gene activation, Stat3 tyrosine phosphorylation, and DNA-binding were inhibited, as was activation of Jak1 and Stat1 by interferon gamma. The kinetics and requirement for new RNA and protein synthesis for inhibition of interleukin 6 by ionomycin and GM-CSF differed, but both agents increased the association of Jak1 with protein tyrosine phosphatase ID (SH2-containing phosphatase 2). Our results demonstrate that crosstalk with distinct signaling pathways can inhibit JAK-STAT signal transduction, and suggest approaches for modulating cytokine activity during immune responses and inflammatory processes.

Modulation of growth factor receptor function by isoform heterodimerization.

Activation of prolactin (PRL)-dependent signaling occurs as the result of ligand-induced dimerization of receptor (PRLr). Although three PRLr isoforms (short, intermediate, and long) have been characterized and are variably coexpressed in PRL-responsive tissues, the functional effects of ligand-induced PRLr isoform heterodimerization have not been examined. To determine whether heterodimeric PRLr complexes were capable of ligand-induced signaling and cellular proliferation, chimeras consisting of the extracellular domain of either the alpha or beta subunit of human granulocyte-macrophage colony-stimulating factor receptor (GM-CSFr) and the intracellular domain of the rat intermediate or short PRLr isoforms (PRLr-I or PRLr-S) were synthesized. Because high affinity binding of GM-CSF is mediated by the extracellular domain of one alpha and beta GM-CSFr pair, use of GM-CSFr/PRLr chimera specifically directed the dimerization of the PRLr intracellular domains within ligand-receptor complexes. Stable transfection of these constructs into the Ba/F3 line was demonstrated by Northern blot and immunoprecipitation analyses. Flow cytometry revealed specific binding of a phycoerythrin-conjugated human GM-CSF to the transfectants, confirming cell surface expression of the chimeric receptors. When tested for their ability to proliferate in response to GM-CSF, only chimeric transfectants expressing GM-CSFr/PRLr-I homodimers demonstrated significant [3H]thymidine incorporation. GM-CSF stimulation of transfectants expressing either GM-CSFr/PRLr-S homodimers or GM-CSFr/PRLr-S+1 heterodimers failed to induce proliferation. Consistent with these data, the GM-CSF-induced activation of two phosphotyrosine kinases, Jak2 and Fyn, was observed only in homodimeric GM-CSFr/PRLr-I transfectants. These results show that the PRLr-S functions as a dominant negative isoform, down-regulating both signaling and proliferation mediated by the receptor complex. Thus, structural motifs necessary for Jak2 and Fyn activation within the carboxy terminus of the PRLr-I, absent in the PRLr-S, are required in each member of the dimeric PRLr complex.

Rel-deficient T cells exhibit defects in production of interleukin 3 and granulocyte-macrophage colony-stimulating factor.

The c-rel protooncogene encodes a subunit of the NF-kappa B-like family of transcription factors. Mice lacking Rel are defective in mitogenic activation of B and T lymphocytes and display impaired humoral immunity. In an attempt to identify changes in gene expression that accompany the T-cell stimulation defects associated with the loss of Rel, we have examined the expression of cell surface activation markers and cytokine production in mitogen-stimulated Rel-/- T cells. The expression of cell surface markers including the interleukin 2 receptor alpha (IL-2R alpha) chain (CD25), CD69 and L-selectin (CD62) is normal in mitogen-activated Rel-/- T cells, but cytokine production is impaired. In Rel-/- splenic T cell cultures stimulated with phorbol 12-myristate 13-acetate and ionomycin, the levels of IL-3, IL-5, granulocyte- macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor alpha (TNF-alpha), and gamma interferon (IFN-gamma) were only 2- to 3-fold lower compared with normal T cells. In contrast, anti-CD3 and anti-CD28 stimulated Rel-/- T cells, which fail to proliferate, make little or no detectable cytokines. Exogenous IL-2, which restitutes the proliferative response of the anti-CD3- and anti-CD28-treated Rel-/- T cells, restores production of IL-5, TNF-alpha, and IFN-gamma, but not IL-3 and GM-CSF expression to approximately normal levels. In contrast to mitogen-activated Rel-/- T cells, lipopolysaccharide-stimulated Rel-/- macrophages produce higher than normal levels of GM-CSF. These findings establish that Rel can function as an activator or repressor of gene expression and is required by T lymphocytes for production of IL-3 and GM-CSF.

Apoptosis of hemopoietic cells by the human granulocyte-macrophage colony-stimulating factor mutant E21R.

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.

Constitutive production of granulocyte/macrophage colony-stimulating factor by hypodense mononuclear eosinophils developed in vitro from hybrid eosinophil/basophil granulocytes.

We recently described the development in vitro of cells with granules characteristic of eosinophils and basophils (hybrid granulocytes) from normal human cord blood mononuclear cells cultured for 14 days with recombinant human (rh) interleukin (IL)-3, rhIL-5, and a soluble basement membrane, Matrigel. Hybrid granulocytes constitutively produced granulocyte/macrophage colony-stimulating factor (GM-CSF) and rapidly developed into eosinophils after the exogenous cytokines and Matrigel were removed. To characterize the developmental progression of hybrid granulocytes, cells were maintained for an additional 14 days in medium containing rhIL-3, rhIL-5, and Matrigel. After 28 days, 73% +/- 1% (mean +/- SEM; n = 6) of the nonadherent cells were mononuclear eosinophils, 13% +/- 3% were eosinophils with two or more nuclear lobes, 13% +/- 4% were hybrid granulocytes, and 0.2% +/- 0.1% were basophils. More than 90% of the mononuclear eosinophils were hypodense as determined by centrifugation through metrizamide gradients. After an additional 5 days of culture in medium without exogenous cytokines, 65% +/- 3% (n = 5) of the 28-day cells excluded trypan blue. In contrast, 2% +/- 1% of freshly isolated peripheral blood eosinophils survived 5 days of culture without exogenous cytokines (n = 5). Fifty percent conditioned medium from in vitro derived 28-day mononuclear eosinophils and 14-day hybrid granulocytes maintained the survival of 60% +/- 7% and 77% +/- 7%, respectively, of freshly isolated peripheral blood eosinophils for 72 h, compared with 20% +/- 8% survival in medium alone (n = 3). The eosinophil viability-sustaining activity of 50% mononuclear eosinophil-conditioned medium was neutralized with a GM-CSF antibody. A total of 88% of the 28-day cells exhibited immunochemical staining for GM-CSF. Thus, during eosinophilopoiesis, both hybrid eosinophil/basophil intermediates and immature mononuclear eosinophils exhibit autocrine regulation of viability due to constitutive production of GM-CSF.

Hematopoietic and lung abnormalities in mice with a null mutation of the common beta subunit of the receptors for granulocyte-macrophage colony-stimulating factor and interleukins 3 and 5.

Gene targeting was used to create mice with a null mutation of the gene encoding the common beta subunit (beta C) of the granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 3 (IL-3; multi-CSF), and interleukin 5 (IL-5) receptor complexes (beta C-/- mice). High-affinity binding of GM-CSF was abolished in beta C-/- bone marrow cells, while cells from heterozygous animals (beta C+/- mice) showed an intermediate number of high-affinity receptors. Binding of IL-3 was unaffected, confirming that the IL-3-specific beta chain remained intact. Eosinophil numbers in peripheral blood and bone marrow of beta C-/- animals were reduced, while other hematological parameters were normal. In clonal cultures of beta C-/- bone marrow cells, even high concentrations of GM-CSF and IL-5 failed to stimulate colony formation, but the cells exhibited normal quantitative responsiveness to stimulation by IL-3 and other growth factors. beta C-/- mice exhibited normal development and survived to young adult life, although they developed pulmonary peribronchovascular lymphoid infiltrates and areas resembling alveolar proteinosis. There was no detectable difference in the systemic clearance and distribution of GM-CSF between beta C-/- and wild-type littermates. The data establish that beta C is normally limiting for high-affinity binding of GM-CSF and demonstrate that systemic clearance of GM-CSF is not mediated via such high-affinity receptor complexes.

Identification of a viability domain in the granulocyte/macrophage colony-stimulating factor receptor beta-chain involving tyrosine-750.

The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Impacto no sistema imunológico da utilização prolongada de morfina para tratamento da dor

Introdução. Apesar das evidências dos efeitos imunomodulatórios da morfina, não há na literatura estudos que tenham comparado a interação entre citocinas, imunidade celular (linfócitos T, B e NK) e a administração prolongada de morfina administrada pelas vias oral ou intratecal em doentes com dor crônica neuropática não relacionada ao câncer. Foram avaliados de forma transversal e comparativa 50 doentes com diagnóstico de dor lombar crônica e com presença de radiculopatia (dor neuropática) previamente operados para tratar hérnia discal lombar (Síndrome Dolorosa Pós- Laminectomia), sendo 18 doentes tratados prolongadamente com infusão de morfina pela via intratecal com uso de sistema implantável no compartimento subaracnóideo (grupo intratecal); 17 doentes tratados prolongadamente com morfina pela via oral (n=17) e 15 doentes tratados com fármacos mas sem opióides (grupo sem opioide). Foram analisadas as concentração das citocinas IL-2, IL-4, IL-8, TNFalfa, IFNy, IL-5, GM-CSF, IL-6, IL-10 e IL-1beta no plasma e no líquido cefalorraquidiano; imunofenotipagem de linfócitos T, B e células NK e avaliados os Índice de Escalonamento de Opióide (em percentagem de opióide utilizada e em mg), dose cumulativa de morfina (mg), duração do tratamento em meses, dose final de morfina utilizada (em mg), e equivalente de morfina por via oral (em mg). Resultados. Não houve diferença estatisticamente significativa entre o número de linfócitos T, B e NK nos doentes com morfina administrada pelas vias IT, VO e os não usuários de morfina. Houve correlação positiva entre as concentrações de linfócitos T CD4 e o Índice de Escalonamento de Opióide (em % e mg) nos doentes tratados com morfina por via intratecal. Houve correlação negativa entre as concentrações de células NK (CD56+) e o Índice de Escalonamento de Opióide (em % e mg) nos doentes tratados com morfina por via intratecal. Houve correlação positiva entre o número de células NK (CD56+) e a dose cumulativa de morfina (em mg) administrada pelas vias intratecal e oral. Houve correlação positiva entre as concentrações de linfócitos T CD8 e a duração do tratamento em meses nos doentes tratados com morfina pela via oral. As concentrações de IL-8 e IL-1beta foram maiores no LCR do que no plasma em todos os doentes da amostra analisada. As concentrações de IFNy no LCR foram maiores nos doentes que utilizavam morfina pela via oral e nos não usuários de morfina do que nos que a utilizavam pela via intratecal. As concentrações de plasmáticas de IL-5 foram maiores nos doentes utilizavam morfina pela via oral ou intratecal do que nos que não a utilizavam. A concentração de IL-5 no LCR correlacionou-se negativamente com a magnitude da dor de acordo com a EVA nos doentes tratados com morfina pelas via oral ou intratecal. Nos doentes tratados com morfina pelas via oral ou intratecal, a concentração de IL-2 no LCR correlacionou-se positivamente com a magnitude da dor de acordo com a EVA e negativamente com o Índice de Escalonamento de Opióide (em % e mg) e a dose cumulativa de morfina (em mg). As concentrações plasmáticas de GMCSF foram maiores nos doentes utilizavam morfina pela via oral ou intratecal do que nos não a utilizavam. A concentração de TNFalfa no LCR nos doentes tratados com morfina pela via intratecal correlacionou-se negativamente com o Índice de Escalonamento de Opióide (em % e mg), a dose cumulativa de morfina (em mg) e dose equivalente por via oral (em mg) de morfina. A concentração plasmática das citocinas IL-6 e IL-10 correlacionou-se negativamente com a duração do tratamento (em meses) nos doentes tratados com morfina administrada pela via oral. O Índice de Escalonamento de Opióide (em mg e %) correlacionou-se negativamente com as concentrações no LCR de IL-2 e TNFalfa nos doentes tratados com morfina administrada pela via intratecal. O Índice de Escalonamento de Opióide (em mg e %) correlacionou-se negativamente com as concentrações no LCR de IL-2 e IL-5 nos doentes tratados com morfina administrada pela via oral. Houve correlação negativa entre a intensidade da dor de acordo com a EVA e as concentrações de IL-5 e IL-2 no LCR nos doentes tratados com morfina administrada pelas vias oral e intratecal. Houve correlação negativa entre a intensidade da dor de acordo com a EVA e as concentrações plasmáticas de IL-4 nos doentes tratados com morfina administrada pela via intratecal. Houve correlação negativa entre a intensidade da dor de acordo com a EVA e as concentrações plasmáticas de IL-1beta nos doentes tratados com morfina administrada pela via intratecal. Conclusões: Os resultados sugerem associações entre citocinas e imunidade celular (células T , B e NK) e o tratamento prolongado com morfina administrada pela via oral ou intratecal. Estes resultados podem contribuir para a compreensão da imunomodulação da morfina administrada por diferentes vias em doentes com dor neuropática crônica não oncológica . São necessários mais estudos sobre os efeitos da morfina sobre o sistema imunológico

Participación de las células supresoras mieloides (CSM) y T regulatorias (Treg) en el control de la infección con Trypanosoma cruzi y el desarrollo de la patología inflamatoria asociada a la infeccion

La infección de mamíferos con el T. cruzi resulta en diferentes alteraciones inmunológicas que permiten la persistencia crónica del parásito y destrucción inflamatoria progresiva del tejido cardiaco, nervioso y hepático. Los mecanismos responsables de la patología de la enfermedad de Chagas han sido materia de intensa investigación habiéndose propuesto que el daño producido en esta enfermedad puede ser consecuencia de la respuesta inflamatoria del individuo infectado y/o de una acción directa del parásito sobre los tejidos del hospedador. El propósito del presente proyecto es estudiar comparativamente, en dos cepas de ratones con diferente susceptibilidad a la infección y desarrollo de patología, la participación y los mecanismos efectores de las células supresoras mieloides (CSM) y las celulas T regulatorias inducidas por la infección experimental con Trypanosoma cruzi en el control de la infección con este protozoario y en el desarrollo de la patología hepática siendo los objetivos especificos desarrolar: - Investigar la generación y/o reclutamiento de células de CSM en bazo e hígado de ratones infectados con Trypanosoma cruzi y su contribución a la desigual susceptibilidad a la infección y respuesta inmune desarrollada en las cepas de ratones BALB/c y C57BL/6; - Investigar la capacidad de las CSM inducidas por la infección con T. cruzi en bazo e hígado de ratones de ambas cepas para suprimir la respuesta de células T in vitro e indagar sobre los mecanismos de supresión utilizados; - Investigar la generación y/o reclutamiento de células Treg durante la infección experimental con Trypanosoma cruzi, su participación en la desigual susceptibilidad a la infección y respuesta inmune desarrollada en ambas cepas de ratones y los mecanismos de supresión utilizados. - Analizar en tejido hepático o leucocitos infiltrantes la presencia de COX2, PGE2, MMP2 y 9, IL1b, IL6, IDO, IL10 y GM-CSF capaces de inducir la expansión de las CSM; - Dilucidar si la administración del ligando para TLR2 (Pam3CyS) previo a la infección de ratones C57BL/6 (en los cuales se detecta un menor número de CSM) es capaz de modular la respuesta inflamatoria y el daño hepático a través de la inducción de CSM y/o T reg en hígado y bazo. La comprension de los eventos celulares y moleculares que regulan la producción de citoquinas pro- y anti-inflamatorias y otros mediadores, así como el papel de los receptores de la inmunidad innata durante la infección con T. cruzi contribuirá a responder interrogantes que son claves para el diseño de nuevas estrategias de intervención inmune tendientes a preservar los mecanismos de defensa del huésped.

Protection from experimental autoimmune encephalomyelitis by polyclonal IgG requires adjuvant-induced inflammation

BACKGROUND Intravenous immunoglobulin (IVIG) proved to be an efficient anti-inflammatory treatment for a growing number of neuroinflammatory diseases and protects against the development of experimental autoimmune encephalomyelitis (EAE), a widely used animal model for multiple sclerosis (MS). METHODS The clinical efficacy of IVIG and IVIG-derived F(ab')2 fragments, generated using the streptococcal cysteine proteinase Ide-S, was evaluated in EAE induced by active immunization and by adoptive transfer of myelin-specific T cells. Frequency, phenotype, and functional characteristics of T cell subsets and myeloid cells were determined by flow cytometry. Antibody binding to microbial antigen and cytokine production by innate immune cells was assessed by ELISA. RESULTS We report that the protective effect of IVIG is lost in the adoptive transfer model of EAE and requires prophylactic administration during disease induction. IVIG-derived Fc fragments are not required for protection against EAE, since administration of F(ab')2 fragments fully recapitulated the clinical efficacy of IVIG. F(ab')2-treated mice showed a substantial decrease in splenic effector T cell expansion and cytokine production (GM-CSF, IFN-γ, IL-17A) 9 days after immunization. Inhibition of effector T cell responses was not associated with an increase in total numbers of Tregs but with decreased activation of innate myeloid cells such as neutrophils, monocytes, and dendritic cells. Therapeutically effective IVIG-derived F(ab')2 fragments inhibited adjuvant-induced innate immune cell activation as determined by IL-12/23 p40 production and recognized mycobacterial antigens contained in Freund's complete adjuvant which is required for induction of active EAE. CONCLUSIONS Our data indicate that F(ab')2-mediated neutralization of adjuvant contributes to the therapeutic efficacy of anti-inflammatory IgG. These findings might partly explain the discrepancy of IVIG efficacy in EAE and MS.

Fusion of interleukin-2 to subunit antigens increase their antigenicity in vitro due to an interleukin-2 receptor beta-mediated antigen uptake mechanism

Subunit vaccines, based on one or more epitopes, offer advantages over whole vaccines in terms of safety but are less antigenic. We investigated whether fusion of the cytokine interleukin-2 (IL-2) to influenza-derived subunit antigens could increase their antigenicity. The fusion of IL-2 to the subunit antigens increased their antigenicity in vitro. Encapsulation of the subunit antigen in liposomes also increased its antigenicity in vitro, yet encapsulation of the subunit IL-2 fusion did not. The use of anti-IL-2 receptor beta (IL-2Rbeta) antibody to block the receptor subunit on macrophages suggested that the adjuvancy exerted by IL-2 in our in vitro system is due to, at least in part, a previously unreported IL-2Rbeta-mediated antigen uptake mechanism.

HPV-16 L1 VLP vaccine elicits a broad-spectrum of cytokine responses in whole blood

Here, we evaluated innate and adaptive immune system cytokine responses induced by HPV-16 L1 VLP in whole blood (WB) cultures from individuals receiving the vaccine (n = 20) or placebo (n = 4) before and after vaccination. 11 cytokines were measured: IL- 1 beta, IL-2, IL-4, IL-5, IL-6, IL-8, 1L- 10, IL- 12, IFN-gamma, TNF-alpha, and GM-CSF using multiplex bead arrays. Cytokine profiles from WB samples clearly discriminated between vaccine and placebo recipients and between pre and post-vaccination responses. Significant increases in Th1, Th2 and inflammatory cytokines were observed in WB assays following vaccination. Results from WB assays were compared against parallel PBMC-based assays in a subset of patients. Differences between whole blood assay and PBMC were observed, with the highest levels of induction found for WB for several cytokines. Our results indicate that multiplex assays for cytokine profiling in WB are an efficient toot for assessing broad spectrum, innate and adaptive immune responses to vaccines and identifying immunologic correlates of protection in efficacy studies. (c) 2005 Elsevier Ltd. All rights reserved.